IthaID: 1290



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 142 (-CC) HGVS Name: HBB:c.429_430delCC
Hb Name: Hb Uzes Protein Info: β 142 (-CC); modified C-terminal sequence: (142)Ala-Gln-Val-Ser-Leu-Ser-Ser-Leu-Ser-Cys- | Cys-Pro-Ile-Ser-Ile-Lys-Gly-Ser-Phe-Val- | Pro-(163)COOH

Context nucleotide sequence:
GTGGCTGGTGTGGCTAATGCCCTGGC [-/CC] ACAAGTATCACTAAGCTCGCTTTC (Strand: -)

Also known as:

Comments: Found as a heterozygote in an elder proband of French Caucasian origin living in Brittany and presenting with normal haematological indices. The deletion generates a frameshift with elongation of the β-globin chain to 162 residues, yet no elongated β-globin chain or more complex species were detected by electrospray ionization mass spectrometry. No abnormal β-globin chain was observed in reversed phase HPLC. Also reported as a structural variant found in a hetrozygous state in a French proband, which was observed in reversed phase HPLC. The presence of two Cys residues in the elongated part may cause some polymerisation.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72003
Size: 2 bp
Located at: β
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β0
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: French
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lacan P, Aubry M, Couprie N, Francina A, Two new beta0-thalassemic mutations: a deletion (-CC) at codon 142 or overlapping codons 142-143, and an insertion (+T) at codon 45 or overlapping codons 44-45/45-46 of the beta-globin gene., Hemoglobin, 31(2), 159-65, 2007 PubMed
Created on 2010-06-16 16:13:17, Last reviewed on 2019-11-22 13:05:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.