IthaID: 129
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 33/34 (GTGGTC>GTC) | HGVS Name: | HBB:c.102_104del |
| Hb Name: | Hb Korea | Protein Info: | β 33(B15) Val>0 |
Context nucleotide sequence:
ATTTTCCCACCCTTAGGCTGCTG [GTGGTC/GTC] TACCCTTGGACCCAGAGGTTCTT (Strand: -)
Also known as:
Comments: Deletion produces the phenotype of dominant beta thalassaemia. The β33 Val (B15) and β34 Val (B16) are essential for the α1 and β1 subunit interactions. It is likely that the deletion of either of the valines in these positions would disrupt the B-helix and prevent α/β dimeric formation and, effectively, functional loss of one half of the β-globin chains. No abnormal haemoglobin was detected on Hb electrophoresis or by the heat denaturation or isopropanol stability tests.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Dominant |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70826 |
| Size: | 3 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Korean |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Park SS, Barnetson R, Kim SW, Weatherall DJ, Thein SL, A spontaneous deletion of beta 33/34 Val in exon 2 of the beta globin gene (Hb Korea) produces the phenotype of dominant beta thalassaemia., British journal of haematology, 78(4), 581-2, 1991 PubMed
- Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2021-05-26 12:25:44 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-06-04 13:11:45 | The IthaGenes Curation Team | Reviewed. Variation location corrected. HbVar link added. |
| 4 | 2019-11-11 15:31:04 | The IthaGenes Curation Team | Reviewed. Mutation names, DNA info and Location corrected. Comment added. |
| 5 | 2021-05-26 12:25:44 | The IthaGenes Curation Team | Reviewed. Allele and protein function corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07