IthaID: 1193
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 115 GCC>GTC [Ala>Val] | HGVS Name: | HBB:c.347C>T |
| Hb Name: | Hb Roma | Protein Info: | β 115(G17) Ala>Val |
Context nucleotide sequence:
GGCAACGTGCTGGTCTGTGTGCTGG [C/T] CCATCACTTTGGCAAAGAATTCACC (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71921 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
HPLC
Disclaimer: The HPLC images are provided as an information resource only.
Bio-Rad Laboratories, Inc and the ITHANET Portal disclaim responsibility and have no liability if this information is used for diagnostic or treatment purposes.
D-10™ and VARIANT™ are registered trademarks of Bio-Rad Laboratories, Inc. and used with permission.
Redistribution and use of the above material is allowed only with permission by Bio-Rad Laboratories, Inc.
To access HPLC images and reports for different variants, use the IthaChrom tool.
| ID | Hb Variant | Gene | Instrument | Method | Area (%) | Ret Time (min) | Comments | ||
|---|---|---|---|---|---|---|---|---|---|
| 445 | Hb Roma | β | D-10 | Dual Kit Program | 28.5 | 4.18 | Elutes with HbA. | [PDF] | |
| 446 | Hb Roma | β | VARIANT | β-thal Short Program | 31.3 | 4.52 | Elutes with HbA. | [PDF] | |
| 447 | Hb Roma | β | VARIANT II | β-thal Short Program | 3.33 | 4.6 | Elutes with HbA. | [PDF] | |
| 448 | Hb Roma | β | VARIANT II | Dual Kit Program | 31.3 | 3.623 | Elutes with HbA. | [PDF] |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Manconi B, De Rosa MC, Cappabianca MP, Olianas A, Carelli Alinovi C, Mastropietro F, Ponzini D, Amato A, Pellegrini M, A new beta-chain haemoglobin variant with increased oxygen affinity: Hb Roma [beta115(g17)Ala-->Val]., Biochimica et biophysica acta, 1800(3), 327-35, 2010 PubMed
Created on 2010-06-16 16:13:17,
Last reviewed on 2019-11-13 17:26:07 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:17 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-09 09:17:40 | The IthaGenes Curation Team | Reviewed. |
| 4 | 2019-11-13 17:26:07 | The IthaGenes Curation Team | Reviewed. HGVS name and Location corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07