IthaID: 113
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | IVS I-110 G>A | HGVS Name: | HBB:c.93-21G>A |
| Hb Name: | N/A | Protein Info: | β nt 252 G>A |
Context nucleotide sequence:
TAGGCACTGACTCTCTCTGCCTATT [G>A] GTCTATTTTCCCACCCTTAGGCTGC (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70796 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Cryptic splice site (mRNA Processing) |
| Ethnic Origin: | Mediterranean, Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Spritz RA, Jagadeeswaran P, Choudary PV, Biro PA, Elder JT, deRiel JK, Manley JL, Gefter ML, Forget BG, Weissman SM, Base substitution in an intervening sequence of a beta+-thalassemic human globin gene., Proceedings of the National Academy of Sciences of the United States of America, 78(4), 2455-9, 1981 PubMed
- Westaway D, Williamson R, An intron nucleotide sequence variant in a cloned beta +-thalassaemia globin gene., Nucleic acids research, 9(8), 1777-88, 1981 PubMed
- Guangkuan Zeng, Yiyuan Ge, Xiaomin Ma, Xiaohua Yu, Bairu Lai, Yuwei Liao, Lili Liu, Yanbin Cao, Yanqing Zeng, Yuchan Huang, Jianlian Liang, Liye Yang, Analysis of five Chinese individuals with rare thalassemia mutation HBB: c.93-21G＞A, Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 41(10), 1171-75, 2024 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2024-10-14 12:00:14 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
| 2 | 2013-11-22 13:29:53 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-16 12:47:53 | The IthaGenes Curation Team | Reviewed. Added ClinVar link. |
| 4 | 2014-04-18 12:29:17 | The IthaGenes Curation Team | Reviewed. Confirmed with DNA sequencing. |
| 5 | 2021-01-20 16:34:53 | The IthaGenes Curation Team | Reviewed. Sequence edits. |
| 6 | 2024-10-14 12:00:14 | The IthaGenes Curation Team | Reviewed. Origin and Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-12 10:33:52