IthaID: 113



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: IVS I-110 G>A HGVS Name: HBB:c.93-21G>A
Hb Name: N/A Protein Info: β nt 252 G>A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAGGCACTGACTCTCTCTGCCTATT [G>A] GTCTATTTTCCCACCCTTAGGCTGC (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70796
Size: 1 bp
Located at: β
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Cryptic splice site (mRNA Processing)
Ethnic Origin: Mediterranean, Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Spritz RA, Jagadeeswaran P, Choudary PV, Biro PA, Elder JT, deRiel JK, Manley JL, Gefter ML, Forget BG, Weissman SM, Base substitution in an intervening sequence of a beta+-thalassemic human globin gene., Proceedings of the National Academy of Sciences of the United States of America, 78(4), 2455-9, 1981 PubMed
  2. Westaway D, Williamson R, An intron nucleotide sequence variant in a cloned beta +-thalassaemia globin gene., Nucleic acids research, 9(8), 1777-88, 1981 PubMed
  3. Guangkuan Zeng, Yiyuan Ge, Xiaomin Ma, Xiaohua Yu, Bairu Lai, Yuwei Liao, Lili Liu, Yanbin Cao, Yanqing Zeng, Yuchan Huang, Jianlian Liang, Liye Yang, Analysis of five Chinese individuals with rare thalassemia mutation HBB: c.93-21G>A, Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 41(10), 1171-75, 2024 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2024-10-14 12:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.