IthaID: 107
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | IVS I-5 (G>C) | HGVS Name: | HBB:c.92+5G>C |
Hb Name: | N/A | Protein Info: | β nt 147 G>C |
Context nucleotide sequence:
TGGTGGTGAGGCCCTGGGCAGGTTG [G/C] TATCAAGGTTACAAGACAGGTTTAA (Strand: -)
Also known as:
Comments: The G>C substitution at the 5th base of IVS 1 disrupts normal splicing. The variant activates three cryptic donor sites that lead to the production of three different abnormally spliced RNAs. The normally spliced RNA is also produced (in vitro experiments).
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70691 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
Ethnic Origin: | Asian Indian, SE Asian, Melanesian, Pakistani |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983 PubMed
- Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984 PubMed
- Hill AV, Bowden DK, O'Shaughnessy DF, Weatherall DJ, Clegg JB, Beta thalassemia in Melanesia: association with malaria and characterization of a common variant (IVS-1 nt 5 G----C)., Blood, 72(1), 9-14, 1988 PubMed
- Kulozik AE, Bail S, Kar BC, Serjeant BE, Serjeant GE, Sickle cell-beta+ thalassaemia in Orissa State, India., British journal of haematology, 77(2), 215-20, 1991 PubMed
- Divoky V, Bissé E, Wilson JB, Gu LH, Wieland H, Heinrichs I, Prior JF, Huisman TH, Heterozygosity for the IVS-I-5 (G-->C) mutation with a G-->A change at codon 18 (Val-->Met; Hb Baden) in cis and a T-->G mutation at codon 126 (Val-->Gly; Hb Dhonburi) in trans resulting in a thalassemia intermedia., Biochimica et biophysica acta, 1180(2), 173-9, 1992 PubMed
- Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016 PubMed
Created on 2010-06-16 16:13:14,
Last reviewed on 2022-03-04 09:49:23 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-08 12:30:10 | The IthaGenes Curation Team | Reviewed. |
4 | 2016-09-02 14:25:45 | The IthaGenes Curation Team | Reviewed. Origin and Reference added. |
5 | 2022-03-04 09:49:23 | The IthaGenes Curation Team | Reviewed. Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-08-12 10:07:42