IthaID: 10



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -87 C>G HGVS Name: HBB:c.-137C>G
Hb Name: N/A Protein Info: β nt -87 C>G
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAGACCTCACCCTGTGGAGCCACAC [A/C/G/T] CTAGGGTTGGCCAATCTACTCCCAG (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70458
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983 PubMed
  2. Diaz-Chico JC, Yang KG, Stoming TA, Efremov DG, Kutlar A, Kutlar F, Aksoy M, Altay C, Gurgey A, Kilinc Y, Mild and severe beta-thalassemia among homozygotes from Turkey: identification of the types by hybridization of amplified DNA with synthetic probes., Blood , 71(1), 248-51, 1988 PubMed
  3. Camaschella C, Alfarano A, Gottardi E, Serra A, Revello D, Saglio G, The homozygous state for the -87 C----G beta + thalassaemia., Br. J. Haematol. , 75(1), 132-3, 1990 PubMed
  4. Gilman JG, Manca L, Frogheri L, Pistidda P, Guiso L, Longinotti M, Masala B, Mild beta+(-87)-thalassemia CACCC box mutation is associated with elevated fetal hemoglobin expression in cis., Am. J. Hematol. , 45(3), 265-7, 1994 PubMed
  5. Ilhan O, Beksaç M, Koç H, Akan H, Keskin A, Arslan O, Gürman G, Ozcan M, Konuk N, Uysal A, HLA-DR frequency in Turkish aplastic anemia patients and the impact of HLA-DR2 positivity in response rate in patients receiving immunosuppressive therapy., Blood , 86(5), 2055, 1995 PubMed
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-04 14:01:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.