IthaGenes

Loading... Please wait!

Quick filtering

Showing all Point-Mutations (Show All):

IthaID	Common Name	Hb Name	HGVS Name	Genes	Functionality	Phenotype	Locus	Position
3720	CD 1/2 (+TG)	N/A	HBA2:c.6_7insTG	α2	Causative	α-thalassaemia	NG_000006.1	33781
3714	CD 15/16 (+T)	N/A	HBA2:c.48_49insT	α2	Causative	α-thalassaemia	NG_000006.1	33823
2207	CD 21/22 +T	N/A	HBA2:c.66dupT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33841
516	CD 37 +GAA [+Glu]	Hb Catonsville	HBA1:c.114_115insGAA \| HBA2:c.114_115insGAA	α1 or α2	Causative	α-chain variant	NG_000006.1	34006, 37810
2217	CD 51/52 +G	N/A	HBA2:c.156_157insG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34048
3079	CD 55 +T	N/A	HBA2:c.168dup	α2	Causative	α-thalassaemia	NG_000006.1	34060
3705	CD 72 (+C)	N/A	HBA2:c.217dup	α2	Causative	α-thalassaemia	NG_000006.1	34109
3632	CD 76/77 (+T)	N/A	HBB:c.231_232insT	α2	Causative	α-thalassaemia	NG_000006.1	34123
644	CD 87 +9 bp [+Ser-Asp-Leu]	Hb Neuilly-sur-Marne	HBA1:c.253_261dup \| HBA2:c.253_261dup	α1 or α2	Causative	α-chain variant	NG_000006.1	34154, 37949
3080	CD 94 (+21 bp duplication)	Hb SKMC	HBA2:c.283_300+3dup	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34175
3365	IVS II-119 (-G) (+CTCGGCCC)	N/A	HBA2:c.301-24delGinsCTCGGCCC	α2	Neutral	N/A	NG_000006.1	34311
721	CD 116-117 +15 bp [+His-Leu-Pro-Ala-Glu]	Hb Zaïre	HBA1:c.337_351dup \| HBA2:c.337_351dup	α1 or α2	Causative	α-chain variant	NG_000006.1	34371, 38182
2527	CD 114 (+CC)	N/A	HBA2:c.344_345dup	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34378
3862	CD 125 (+C)	N/A	HBA2:c.376dupC	α2	Causative	α-thalassaemia	NG_000006.1	34410
4085	CD 132 (+T)	Hb Balkh	HBA2:c.398dup	α2	Causative	α-chain variant	NG_000006.1	34432
2352	CD 2/3 +CTG [+Leu]	Hb Pittsburgh	HBA1:c.9_10insCTG	α1	Causative	α-chain variant	NG_000006.1	37588
2205	CD 20 +T	N/A	HBA1:c.62_63insT	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37641
3403	CD 39 +A	N/A	HBA2:c.118_119insA	α2	Causative	α-thalassaemia	NG_000006.1	37814
2468	CD 44 +C	N/A	HBA1:c.134_135insC	α1	Causative	α-thalassaemia	NG_000006.1	37830
2529	CD 50 +GGAGCC	Hb Bakersfield	HBA1:c.151_152insGGAGCC	α1	Causative	α-chain variant	NG_000006.1	37847
3442	CD 51-58 (+24 bp)	Hb Choisy	HBA1:c.157_180dupTCTGCCCAGGTTAAGGGCCACGGC	α1	Causative	α-chain variant	NG_000006.1	37853
3075	CD 56/57 (+24bp) (HBA1:p.Lys57_Gly58insSerHisGlySerAlaGlnValLys , Hb KSVGH)	Hb Kaohsiung Veterans General Hospital	HBA1:c.171_172insAGCCACGGCTCTGCCCAAGTTAGG	α1	Causative	α-chain variant	NG_000006.1	37868
597	CD 68 +GCGCTGACCAAC [+Ala-Leu-Thr-Asn]	Hb Esch	HBA1:c.207_208insGCGCTGACCAAC	α1	Causative	α-chain variant	NG_000006.1	37904
390	CD 93-99 (+21 bp)	N/A	HBA1:c.280_300ins21	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37976
2539	IVS II-3 (+21bp)	Hb SKMC	HBA1:c.283_300+3dup	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37979
723	CD 118-119 +9 bp [+Glu-Phe-Thr] (Hb Dakar)	Hb Grady	HBA1:c.349_357dup	α1	Causative	α-chain variant	NG_000006.1	38194
3281	CD 130 (+T)	Hb Sichuan	HBA1:c.393_394insT	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	38238
416	CD 131 (+T) >175aa	Hb Pak Num Po	HBA1:c.396dup	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	38241
3739	TTS +23 (+T)	N/A	HBA1:c.134_135insT	α1	Causative	α-thalassaemia	NG_000006.1	38408
3573	rs3834466	N/A	NG_000007.3:g.27282dup	β	Neutral	N/A	NG_000007.3	27282
3943	-200 (+CC)	N/A	HBG2:c.-253_-254dup	Gγ	Causative	HPFH	NG_000007.3	42634
1556	-200 +C (Tunisian non-deletional HPFH)	N/A	HBG2:c.-253dup	Gγ	Causative	HPFH, Hb F levels	NG_000007.3	42635
3865	-219 (+AGCA)	N/A	HBG1:c.-272_-275dup	Aγ	Causative	HPFH	NG_000007.3	47537
2563	IVS I-1 (27 bp insertion)	N/A	HBD:c.92+83_84ins27	δ	Causative	δ-thalassaemia	NG_000007.3	63357
2575	CD 58 +C	N/A	HBD:c.176_177insC	δ	Causative	δ-thalassaemia	NG_000007.3	63486
3237	CD 59/60 (+GG)	N/A	HBD:c.180_181dup	δ	Causative	δ-thalassaemia	NG_000007.3	63490
1338	CD 91 (+T)	N/A	HBD:c.275dupT	δ	Causative	δ-thalassaemia	NG_000007.3	63585
2521	CD 110-111 +GT	N/A	HBD:c.333_334insGT	δ	Causative	δ-thalassaemia, δ-chain variant	NG_000007.3	64541
3234	CD 113 (+TG)	N/A	HBD:c.341_342dupTG	δ	Causative	δ-thalassaemia	NG_000007.3	64549
33	-22 to +23 (+45 bp duplication)	N/A	NG_000007.3:g.70573_70617dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70573
52	CD 3 (+T)	N/A	HBB:c.11dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70605
2958	CD 7/8 (+G)	N/A	HBB:c.24dupG	β	Causative	β-thalassaemia	NG_000007.3	70618
2185	CD 8/9 +AGAA	N/A	HBB:c.27_28insAGAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70620
62	CD 8/9 (+G)	N/A	HBB:c.27dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
63	CD 9 (+TA)	N/A	HBB:c.28_29insTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70622
64	CD 9/10 (+T)	Hb Gaziantep	HBB:c.30dupT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70624
4108	CD 10 GCC>GTC [Ala>Val]	N/A	HBB:c.31_32insT	β	Causative	β-thalassaemia	NG_000007.3	70625
68	CD 14 (+T)	N/A	HBB:c.44dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
69	CD 14/15 (+G)	N/A	HBB:c.45dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70639
71	CD 15/16 (+G)	N/A	HBB:c.50dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
78	CD 17 (+A)	N/A	HBB:c.53dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70647
81	CD 20/21 (+G)	N/A	HBB:c.64dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
87	CD 25/26 (+T)	N/A	HBB:c.78dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70672
90	CD 26 (+T)	N/A	HBB:c.79_80insT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
92	CD 27/28 (+C)	N/A	HBB:c.85dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
124	IVS I [3' end] (+22bp)	N/A	NG_000007.3:g.70807_70828dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70807
125	CD 30/31 +CGG [+Arg]	N/A	HBB:c.93_94insCGG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70817
144	CD 40 (+86 bp) (HGSA)	N/A	HBB:c.123_208dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
145	CD 40/41 (+T)	N/A	HBB:c.125dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70849
148	CD 42/43 (+T)	N/A	HBB:c.129dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70853
149	CD 42/43 (+G)	N/A	HBB:c.130dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
153	CD 45 (+T)	N/A	HBB:c.138dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
154	CD 45/46 (+A)	N/A	HBB:c.138_139insA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
2960	CD 46/47 (+G)	N/A	HBB:c.142_142dupG	β	Causative	β-thalassaemia	NG_000007.3	70866
155	CD 47 (+A)	N/A	HBB:c.143dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
156	CD 47/48 (+ATCT)	N/A	HBB:c.143_146dupATCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
161	CD 53/54 (+G)	N/A	HBB:c.163dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70887
163	CD 54/55 (+A)	N/A	HBB:c.166dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
166	CD 56-60 (+14 bp)	N/A	HBB:c.170_183dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70894
167	CD 58 (+C)	N/A	HBB:c.176dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70900
3944	CD 64 (+G)	N/A	HBB:c.194dup	β	Causative	β-thalassaemia	NG_000007.3	70918
2525	CD 68/69 (+AAAGTGCTC)	Hb Bronx	HBB:c.199_207dupAAAGTGCTC	β	Causative	β-chain variant, Haemolytic anaemia	NG_000007.3	70923
1029	CD 69 (+GCTCGG)	Hb Nishinomiya	HBB:c.204_209dupGCTCGG	β	Causative	β-chain variant	NG_000007.3	70928
176	CD 71 (+T)	N/A	HBB:c.216dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70940
177	CD 71/72 (+A)	N/A	HBB:c.217dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
2181	CD 72/73 (+T)	N/A	HBB:c.219dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70943
1043	CD 73-75 (-GATGGCCTG; + Ala-Arg-Cys-Gln)	Hb Montreal	HBB:c.220_228delinsGCTCGGTGCCAG	β	Causative	β-chain variant	NG_000007.3	70944
3299	CD 77/78 (+C)	N/A	HBB:c.235dupC	β	Causative	β-thalassaemia	NG_000007.3	70959
187	CD 84/85 (+C)	N/A	HBB:c.255dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70979
188	CD 84-86 (+T)	N/A	HBB:c.258dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70982
189	CD 88 (+T)	N/A	HBB:c.266dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
1118	CD 94/95 +15 bp [+Glu-Leu-His-Cys-Asp]	Hb Fairfax	HBB:c.271_285dupGAGCTGCACTGTGAC	β	Causative	β-chain variant, Haemolytic anaemia	NG_000007.3	70995
3057	CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG)	N/A	HBB:c.272_295dup	β	Causative	β-thalassaemia	NG_000007.3	70996
1124	CD 95/96 (+15 bp)	Hb Koriyama	HBB:c.274_288dup	β	Causative	β-chain variant	NG_000007.3	70998
194	CD 91 (+T)	N/A	HBB:c.275dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
195	CD 93/94 (+TG)	Hb Agnana	HBB:c.282_283dupTG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71006
196	CD 95 (+A)	N/A	HBB:c.287dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71011
3888	CD 97/98 (+GCAC)	N/A	HBB:c.291_294dup	β	Causative	β-thalassaemia	NG_000007.3	71015
2966	CD 98/99 (+TG)	Hb Patagonia	HBB:c.296_297dup	β	Causative	β-chain variant	NG_000007.3	71020
198	CD 100 (-CC,+TCTGAGAACTT) >158aa	N/A	HBB:c.301_302delCCinsTCTGAGAACTT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71025
2279	CD 102 AAC>ATCAC	N/A	HBB:c.308insTC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71032
3796	IVS II-716 (+T)	N/A	HBB:c.316-135dupT	β	Causative	β-thalassaemia	NG_000007.3	71755
2200	IVS II-765 L1 insertion (+CTGCTTTTATTTT)	N/A	HBB:c.316-98_316-86dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71792
231	CD 107 (+G)	N/A	HBB:c.323dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
1195	CD 112-116 (+GTGTGCTGGCCC)	Hb Antibes-Juan-Les-Pins	HBB:c.338_349dupGTGTGCTGGCCC	β	Causative	β-chain variant	NG_000007.3	71912
2192	CD 114/115 (+TGTGCTG)	N/A	HBB:c.339_345dupTGTGCTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
240	CD 116 (+TGAT)	N/A	HBB:c.349_350insTGAT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71924
243	CD 120/121 (+A)	N/A	HBB:c.363dupA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71937
3555	CD 124 (+C)	N/A	HBB:c.374dup	β	Causative	β-thalassaemia, Haemolytic anaemia	NG_000007.3	71948
2194	CD 124/125 (+A)	N/A	HBB:c.375dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
248	CD 125 (+CCA)	N/A	HBB:c.376_378dupCCA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71950
3227	CD 125-126 (+CCAGT)	N/A	HBB:c.376_380dupCCAGT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71950
2197	CD 131 (+A)	N/A	HBB:c.395dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71969
259	CD 131/132 (+GCCT)	N/A	HBB:c.396_397insGCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
2282	CD 139/140 +T [163 aa]	Hb Boston-Kuwait	HBB:c.420dupT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71994
1306	CD 145 (+CT)	Hb Cranston	HBB:c.436_437insCT	β	Causative	β-chain variant	NG_000007.3	72010
1319	CD 146/147 (+AC)	Hb Tak	HBB:c.440_441dupAC	β	Causative	β-chain variant	NG_000007.3	72014
1320	CD 147 (+TA)	Hb Monplaisir	HBB:c.442_443dupTA	β	Causative	β-chain variant	NG_000007.3	72016
3933	3'UTR +116 (+A) (β nt + 1590 (+A))	N/A	HBB:c.*116dup	β	Causative	β-thalassaemia	NG_000007.3	72134
3930	TTS +43 (+A) (β nt +1651 (+A))	N/A	HBB:c.*177dup	β	Causative	β-thalassaemia	NG_000007.3	72195
4103	p.Gly176AlafsX179	N/A	NC_000019.10(NM_006563.5):c.525_526insGCGCCGG	KLF1	Modifier	N/A	NG_013087.1	6499
2085	CD 175/176 (+7bp): (+CGGCGCC) (c.519_525dupCGGCGCC, p.Gly176Argfs*179)	N/A	NG_013087.1:g.6493_6499dupCGGCGCC	KLF1	Modifier	Hb F levels, Anaemia	NG_013087.1	6500
2278	CD 302 (+4bp): (+GCGC)	N/A	NG_013087.1:g.6877_6878insGCGC	KLF1	Modifier	Hb F levels	NG_013087.1	6877
2296	CD 319 (+1bp): (+G)	N/A	NG_013087.1:g.7184dupG	KLF1	Modifier	N/A	NG_013087.1	7184
2789	rs3074372	N/A	NG_023030.1:g.4828_4829insGT	HMOX1	Modifier	Acute chest syndrome	NG_023030.1	4828
2867	rs8175347	N/A	NG_002601.2:g.175492_175493TA[5][6][7][8]	UGT1A1	Modifier	Hb F levels, Gallstones, Bilirubin levels, Abnormal red blood cell count, Anaemia	NG_002601.2	175492
2287	-126 (-TTT) (12020(T15>T18), c.-126TdelTTT, rs5816533 )	N/A	NT_010393.16:g.31479059delTTT	AHSP	Modifier	Anaemia	NT_010393.16	31479059
2666	rs3025058 (MMP3 -1171insA , -1171 5A/6A MMP-3)	N/A	NG_012100.1:g.3394_3395insT	MMP3	Modifier	Stroke	NG_012100.1	3394
3219	rs557939075	N/A	NG_009929.2:g.459084_459085insA	LARGE1	Modifier	Hb F levels	NG_009929.2	459084

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.