IthaGenes

Loading... Please wait!

Quick filtering

Showing all Point-Mutations (Show All):

IthaID	Common Name	Hb Name	HGVS Name	Genes	Functionality	Phenotype	Locus	Position
3051	Init CD ACCATG>-CCATG	N/A	HBA2:c.-3delA	α2	Causative	α-thalassaemia	NG_000006.1	33773
344	Init CD ATG>-TG	N/A	HBA2:c.1delA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33776
343	Init CD ATG>A-G	N/A	HBA2:c.2delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33777
4071	CD 1 (-G)	N/A	HBA2:c.4del	α2	Causative	α-thalassaemia	NG_000006.1	33779
2206	CD 8 (-C)	N/A	HBA2:c.27delC	α2	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	33802
2433	CD 13-14 -GCCTGG [-Ala-Trp]	Hb Souli	HBA2:c.40_45delGCCTGG	α2	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	33815
3885	CD 17 (-C) (Hb Kunming)	N/A	HBA2:c.54delC	α2	Causative	α-thalassaemia	NG_000006.1	33829
350	CD 18 GGC>G-C	N/A	HBA2:c.56delG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33831
353	CD 22 -C	N/A	HBA2:c.69delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33844
2438	CD 22-26 (-9 bp)	Hb Zhanjiang	HBA2:c.69_77delCGAGTATGG	α2	Causative	α-chain variant	NG_000006.1	33844
3568	CD 28 GCC>-CC	N/A	HBA2:c.85delG	α2	Causative	α-thalassaemia	NG_000006.1	33860
357	CD 30 -GAG [-Glu]	N/A	HBA2:c.91_93delGAG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33866
359	IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor (α-5nt)	N/A	HBA2:c.95+2_95+6delTGAGG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33872
3729	IVS I-11 (-24bp) (Hb Qujing)	N/A	HBA2:c.95+11_95+34del	α2	Causative	α-thalassaemia	NG_000006.1	33881
2211	CD 37 CCC>CC-	N/A	HBA2:c.114delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34006
3765	CD 39 (-ACC) [-Thr]	Hb Taybe	HBA2:c.118_120del	α2	Causative	α-thalassaemia, α-chain variant	NG_000006.1	34010
2493	CD 40 AAG>AA-	N/A	HBA2:c.123delG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34015
2214	CD 43 TTC>T-C	N/A	HBA2:c.131delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34023
2215	CD 43/44 -C	N/A	HBA2:c.132delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34024
3405	CD 47-53 (-20bp): (-GACCTGAGCCACGGCTCTGC)	N/A	HBA2:c.142_161del	α2	Causative	α-thalassaemia	NG_000006.1	34034
2216	CD 47 -A	N/A	HBA2:c.143delA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34035
3053	CD 47/48 (-4bp): (-ACCT)	N/A	HBA2:c.143_146delACCT	α2	Causative	α-thalassaemia	NG_000006.1	34035
2535	CD 48-54 -18 bp	Hb Fenton	HBA2:c.146_163delTGAGCCACGGCTCTGCCC	α2	Causative	α-chain variant	NG_000006.1	34038
374	CD 49 -GC	N/A	HBA2:c.149_150delGC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34041
2955	CD 49-57 (-24bp): (-GCCACGGCTCTGCCCAGGTTAAGG)	Hb Goya	HBA2:c.149_172del	α2	Causative	α-chain variant	NG_000006.1	34041
3039	CD 52-59 (-24bp): (-TCTGCCCAGGTTAAGGGCCACGGC)	Hb J-Biskra	HBA2: c.157_180del	α2	Causative	α-chain variant	NG_000006.1	34049
3693	CD 54 CAG>-AG	N/A	HBA2:c.163delC	α2	Causative	α-thalassaemia	NG_000006.1	34055
3054	CD 56 AAG>--G	N/A	HBA2:c.169_170delAA	α2	Causative	α-thalassaemia	NG_000006.1	34061
2218	CD 63-76 (-42 bp)	N/A	HBA2:c.190_231del	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34082
2576	CD 68 AAC>A-C	N/A	HBA2:c.206delA	α2	Causative	α-thalassaemia	NG_000006.1	34098
4070	CD 68 (-C)	N/A	HBA2:c.207del	α2	Causative	α-thalassaemia	NG_000006.1	34099
3055	CD 73/74 (-4bp): (-GTGG)	N/A	HBA2:c.220_223delGTGG	α2	Causative	α-thalassaemia	NG_000006.1	34112
611	CD 75 (-GAC)	Hb Watts	HBA2:c.226_228del	α2	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	34118
3974	CD 82-83 (-CCTG)	N/A	HBA2:c.249_252del	α2	Causative	α-thalassaemia	NG_000006.1	34141
3569	CD 89-93 (-13bp): (-CACAAGCTTCGGG)	N/A	HBA2:c.268_280delCACAAGCTTCGGG	α2	Causative	α-thalassaemia	NG_000006.1	34160
3572	CD 90‐92 (-8bp): (‐AGCTTCGG)	N/A	HBA2:c.272_279delAGCTTCGG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34164
2436	CD 107 GTG>G-G	Hb Lynwood	HBA2:c.323delT	α2	Causative	α-thalassaemia, α-chain variant	NG_000006.1	34357
398	CD 109 (-C)	Hb Sciacca	HBA1:c.328delC	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	34362
4068	CD 112 CAC>-AC	N/A	HBA2:c.337delC	α2	Causative	α-thalassaemia	NG_000006.1	34371
402	CD 112/113 -C	N/A	HBA2:c.339delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34373
3140	CD 114 CCC>CC-	N/A	HBA2:c.345delC	α2	Causative	α-thalassaemia	NG_000006.1	34379
2369	CD 115 -GCC [-Ala]	Hb Towson	HBA2:c.346_348delGCC	α2	Causative	α-chain variant	NG_000006.1	34380
2221	CD 115 -GAGTTCACCCC [166 aa]	N/A	HBA2:c.349_359delGAGTTCACCCC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34383
3305	CD 126 GCG>-CG	N/A	HBA2:c.379delG	α2	Causative	α-thalassaemia	NG_000006.1	34413
2480	CD 129 CTG>-TG	Hb Hamilton Hill	HBA2:c.388delC	α2	Causative	α-chain variant	NG_000006.1	34422
3404	CD 133-135 (-AGCACCG)	Hb Aalesund	HBA2:c.400_406del	α2	Causative	α-chain variant	NG_000006.1	34434
428	3'UTR -16 bp	N/A	HBA2:c.74_89delCCTTCCTGGTCTTTGA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34537
3250	Init CD ATG>A-G	N/A	HBA1:c.2delT	α1	Causative	α-thalassaemia	NG_000006.1	37581
4006	CD 7 AAG>A-G (g.188 (GenBank MK600512.1))	N/A	HBA1:c.23delA	α1	Causative	α-thalassaemia	NG_000006.1	37602
370	CD 37 -CCC [-Pro)	Hb Heraklion	HBA1:c.112_114delCCC	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37808
4077	CD 37 CCC>CC-	N/A	HBA1:c.114del	α1	Causative	α-thalassaemia	NG_000006.1	37810
371	CD 39 (-ACC) [-Thr]	Hb Taybe	HBA1:c.118_120del	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37814
3856	CD 40-41 (-AAGACC)	N/A	HBA1:c.121_126delAAGACC	α1	Causative	α-thalassaemia	NG_000006.1	37817
556	CD 52-59 (-24 bp)	Hb J-Biskra	HBA1:c.157_180del	α1	Causative	α-chain variant	NG_000006.1	37853
380	CD 61 (-AAG)	Hb Clinic	HBA1:c.184_186del	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37880
3717	CD 61 AAG>-AG	N/A	HBA1:c.184del	α1	Causative	α-thalassaemia	NG_000006.1	37880
381	CD 62 (-GTG) [-Val]	Hb Aghia Sophia	HBA1:c.187_189del	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37883
382	CD 62 GTG>-TG	Hb Champaign	HBA1:c.187delG	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37883
2347	CD 62 -G	N/A	HBA1:c.189delG	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37885
383	CD 64-74 (-33 bp)	N/A	HBA1:c.193_225del33	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37889
3373	CD 67 ACC>-CC	N/A	HBA1:c.202delA	α1	Causative	α-thalassaemia	NG_000006.1	37898
385	CD 74/75 -GAC [- Asp]	N/A	HBA1:c.212_214delGAC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37908
4008	CD 72 CAC>CA- (g.502 (GenBank: MK600512.1))	N/A	HBA1:c.219delC	α1	Causative	α-thalassaemia	NG_000006.1	37915
3326	CD 73 GTG>G-G	N/A	HBA1:c.221delT	α1	Causative	α-thalassaemia	NG_000006.1	37917
386	CD 78 -C	N/A	HBA1:c.237delC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37933
2219	CD 81 -T	N/A	HBA2:c.244delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37940
3861	CD 87 (-A)	N/A	HBA1:c.263delA	α1	Causative	α-thalassaemia	NG_000006.1	37959
4093	CD 95 (-C)	Hb Campania	HBA1:c.287delC	α1	Causative	α-thalassaemia, α-chain variant	NG_000006.1	37983
4042	IVS II-2 (-8 bp, +1 bp)	N/A	HBA1:c.301-31_301-24delinsG	α1	Causative	α-thalassaemia	NG_000006.1	38115
2224	CD 110-114 (-13 bp)	N/A	HBA1:c.333_345delCGCCCACCTCCCC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	38178
4084	CD 133-135 (-7 bp, -GCACCGT)	N/A	HBA1:c.401_407del	α1	Causative	α-thalassaemia	NG_000006.1	38246
760	CD 134 -C	Hb Senlis	HBA1:c.404delC	α1	Causative	α-chain variant, Haemolytic anaemia	NG_000006.1	38249
3483	CD 121 GAA>-AA	Hb Mahasarakham	HBB:c.364delG	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	6394
3272	-533 (-ATAAG)	N/A	HBG2:c.-533_-529delATAAG	Gγ	Causative	HPFH, Hb F levels	NG_000007.3	42302
1467	CD 23 (-GCT)	Hb F-Mauritius	HBG1:c.70_72del	Aγ	Causative	γ-chain variant	NG_000007.3	47881
3231	CD 7 (-3bp): (-GAG)	N/A	HBD:c.22_24delGAG	δ	Causative	δ-thalassaemia	NG_000007.3	63204
3232	CD 10 GCT>-CT	N/A	HBD:c.31delG	δ	Causative	δ-thalassaemia	NG_000007.3	63213
3233	IVS I 3' AG>-C	N/A	HBD:c.93-2delA	δ	Causative	δ-thalassaemia	NG_000007.3	63401
3806	CD 44-48 (-CTTTGGGGATC) (p.Phe46Valfs*4)	N/A	HBD:c.135_145del	δ	Causative	δ-thalassaemia	NG_000007.3	63445
3441	CD 59 AAG>A-G (δ0 59 (-A))	N/A	HBD:c.179delA	δ	Causative	δ-thalassaemia	NG_000007.3	63489
3236	CD 87 CAG>C-G	N/A	HBD:c.263delA	δ	Causative	δ-thalassaemia	NG_000007.3	63573
3598	CD 93/94 (-TG) [Cys>STOP]	N/A	HBD:c.282_283delTG	δ	Causative	N/A	NG_000007.3	63592
3975	CD 98 (-GTG, +A)	N/A	HBD:c.295_297delGTGinsA	δ	Causative	δ-thalassaemia	NG_000007.3	63605
2482	CD 137 -GTG [-Val] (Hb Anti-Lepore Lincoln Park)	Hb Lincoln Park	HBD:c.412_414delGTG	δ	Causative	δ-chain variant, Haemolytic anaemia	NG_000007.3	64620
3752	-99 to -85 (-15bp)	N/A	HBB:c.-149_-135delGTGGAGCCACACCCT	β	Causative	β-thalassaemia	NG_000007.3	70446
3990	-89 to -88 (-AC)	N/A	HBB:c.-139_-138delAC	β	Causative	β-thalassaemia	NG_000007.3	70456
3925	-42 (-C)	N/A	HBB:c.-92delC	β	Causative	β-thalassaemia	NG_000007.3	70503
3062	-30 (-T)	N/A	HBB:c.-80delT	β	Causative	β-thalassaemia	NG_000007.3	70515
24	-29 to -26 (-AA)	N/A	HBB:c.-79_78delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70516
31	-27 (-AA)	N/A	HBB:c.-77_-76delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70518
36	CAP +10 (-T) (5'UTR +10 (-T))	N/A	HBB:c.-41delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70554
3627	CAP +20 (-C)	N/A	HBB:c.-31delC	β	Causative	β-thalassaemia	NG_000007.3	70564
40	CAP +41 to +44 (-AACA) (CAP +40 to +43 (-AAAC))	N/A	HBB:c.-10_-7delAACA	β	Causative	β-thalassaemia	NG_000007.3	70585
50	CD 1 (-G)	N/A	HBB:c.4delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70598
51	CD 2-4 (-9 bp, +31 bp)	N/A	HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
3437	CD 2 CAT>-AT	Hb Bundelkhand	HBB:c.7delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
3014	CD 2 CAT>C-T	N/A	HBB:c.8delA	β	Causative	β-thalassaemia	NG_000007.3	70602
53	CD 2/3 (+T); CD 5 (-C)	Hb Antalya	HBB:c.[9dupT; 17delC]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70603, 70611
3561	CD 2 CAT/CA-	N/A	HBB:c.9delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70603
3817	CD 4 (-T)	N/A	HBB:c.14delC	β	Causative	β-thalassaemia	NG_000007.3	70608
54	CD 5 -CT	N/A	HBB:c.17_18delCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70611
2180	CD 5/6 -TG	N/A	HBB:c.18_19delTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70612
2184	CD 6-14 (-26 bp) (26 bp deletion)	N/A	HBB:c.20_45del26bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
57	CD 6 -A	N/A	HBB:c.20delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
58	CD 6 (-G)	N/A	HBB:c.20delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
59	CD 6-10 (-13 bp)	N/A	HBB:c.21_33delGGAGAAGTCTGCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70615
828	CD 7 (-GAG) [-Glu] (Hb Xinyi)	Hb Leiden	HBB:c.22_24delGAG	β	Causative	β-chain variant	NG_000007.3	70616
3288	CD7 GAG>G-G	N/A	HBB:c.23delA	β	Causative	β-thalassaemia	NG_000007.3	70617
61	CD 8 (-AA)	N/A	HBB:c.25_26delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70619
3399	CD 9 TCT>TC-	Hb Antep	HBB:c.30delT	β	Causative	β-chain variant	NG_000007.3	70624
66	CD 10 (-C)	N/A	HBB:c.33delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70627
3297	CD 11-13 (-9bp): (-GTTACTGCC)	Hb JC-Paz	HBB:c.34_42delGTTACTGCC	β	Causative	β-chain variant	NG_000007.3	70628
67	CD 11 (-T)	N/A	HBB:c.36delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70630
3721	CD 14 CTG>-TG	N/A	HBB:c.43delC	β	Causative	β-thalassaemia	NG_000007.3	70637
2553	CD 14 CTG>C-G	N/A	HBB:c.44delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
70	CD 15 (-T)	N/A	HBB:c.46delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70640
74	CD 15/16 (-G)	N/A	HBB:c.50delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
75	CD 16 GGC>GG-	N/A	HBB:c.51delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70645
855	CD 17-19 (-GGTGAA)	Hb Lyon	HBB:c.54_59del	β	Causative	β-chain variant	NG_000007.3	70648
3609	CD 20/21 (-TGGA)	N/A	HBB:c.62_65delTGGA	β	Causative	β-thalassaemia	NG_000007.3	70656
80	CD 20-22 (GTGGATGAA>GTGAA)	N/A	HBB:c.64_67del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
84	CD 22-24 ( -7 bp): (-AAGTTGG)	N/A	HBB:c.68_74delAAGTTGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70662
878	CD 23/24 (GTTGGT>GGT)	Hb Freiburg	HBB:c.71_73del	β	Causative	β-chain variant	NG_000007.3	70665
85	CD 24 (-G, +CAC)	N/A	HBB:c.74delinsCAC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
3306	CD 25/26 -GTG [-Gly] (Hb Higashitochigi, Hb HT)	Hb M Dothan	HBB:c.77_79delGTG	β	Causative	β-chain variant	NG_000007.3	70671
93	CD 28 (-C)	N/A	HBB:c.85delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
95	CD 28/29 (-G)	N/A	HBB:c.89delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70683
3484	CD 30 (-A) or IVS I (-2) AGG>-GG	N/A	HBB:c.91delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
280	IVS I [3' end] (-25 bp) (25 bp deletion)	N/A	NC_000011.10(NM_000518.4):c.93-22_95del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70795
2173	IVS I-109 (-T)	N/A	HBB:c.93-22delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70795
121	IVS I [3' end] (-17 bp) (17 bp deletion)	N/A	HBB:c.93-17_93-1delTATTTTCCCACCCTTAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70800
126	CD 31 (-C)	N/A	HBB:c.94delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70818
131	CD 33-35 (-TGGTCT)	Hb Dresden	HBB:c.101_106delTGGTCT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70825
129	CD 33/34 (GTGGTC>GTC)	Hb Korea	HBB:c.102_104del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70826
130	CD 33-34 (-G)	N/A	HBB:c.102_103delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70826
3692	CD 35 (TAC>TA-)	N/A	HBB:c.108delC	β	Causative	β-thalassaemia	NG_000007.3	70832
128	CD 36 CCT>C-T (CD 36 (-C))	N/A	HBB:c.110del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70834
135	CD 36-39 (-8 bp)	N/A	HBB:c.111_118delTTGGACCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70835
134	CD 36/37 (-T)	N/A	HBB:c.112delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70836
136	CD 37 (-G)	N/A	HBB:c.114delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
139	CD 37-39 (-7 bp): (-GACCCAG)	N/A	HBB:c.114_120del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
141	CD 38/39 (-CC)	N/A	HBB:c.117_118delCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70841
140	CD 38/39 (-C)	N/A	HBB:c.118delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
2393	CD 39 -A	N/A	HBB:c.119delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70843
143	CD 40 (-G)	N/A	HBB:c.123delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
146	CD 41 (-C)	N/A	HBB:c.126delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
147	CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT))	N/A	HBB:c.126_129delCTTT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
945	CD 42 (-TTT)	Hb Bruxelles	HBB:c.127_129delTTT	β	Causative	β-chain variant	NG_000007.3	70851
2954	CD 42 TTT>TT-	Hb Yala	HBB:c.129delT	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	70853
946	CD 43-46 (-9bp)	Hb Niteroi	HBB:c.131_139del	β	Causative	β-chain variant, Haemolytic anaemia	NG_000007.3	70855
151	CD 44 -C	N/A	HBB:c.135delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70859
152	CD 45 (-T)	N/A	HBB:c.138delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
2187	CD 48 -T	N/A	HBB:c.146delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70870
2407	CD 49-55 (-19 bp +4 bp)	Hb Martinez	HBB:c.149_167delinsAGCT	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	70873
157	CD 49 (-C)	N/A	HBB:c.150delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70874
158	CD 50 (-T)	N/A	HBB:c.153delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70877
159	CD 51 (-C)	N/A	HBB:c.155delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70879
2959	CD 52 GAT>G-T	N/A	HBB:c.158delA	β	Causative	β-thalassaemia	NG_000007.3	70882
160	CD 53 (-T)	N/A	HBB:c.162delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70886
4094	CD 54 GTT>-TT	N/A	HBB:c.163del	β	Causative	β-thalassaemia	NG_000007.3	70887
162	CD 54 -T	N/A	HBB:c.165delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
165	CD 55 (-A)	N/A	HBB:c.166delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
2990	CD 55-59 (-13 bp)	N/A	HBB:c.167_179del	β	Causative	β-thalassaemia	NG_000007.3	70891
989	CD 56-60 (-12bp)	Hb Tochigi	HBB:c.170_181del	β	Causative	β-chain variant	NG_000007.3	70894
3311	CD 58 CCT>C-T	N/A	HBB:c.176delC	β	Causative	β-thalassaemia	NG_000007.3	70900
168	CD 59 -A	N/A	HBB:c.179delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70903
4086	CD 59 AAG>AA-, CD 59 (-G)	N/A	HBB:c.180del	β	Causative	β-thalassaemia	NG_000007.3	70904
3855	CD 60 GTG>-TG [Val>STOP]	N/A	HBB:c.181delG	β	Causative	β-thalassaemia	NG_000007.3	70905
3298	CD 60-61 (-6bp): (-TGAAGG)	Hb Tavapy	HBB:c.182_187delTGAAGG	β	Causative	β-chain variant	NG_000007.3	70906
3589	CD 62-65 (-12bp)	N/A	HBB:c.187_198delGCTCATGGCAAG	β	Causative	β-thalassaemia, Haemolytic anaemia	NG_000007.3	70911
171	CD 62-64 (-7bp)	N/A	HBB:c.189_195delTCATGGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70913
173	CD 64 (-G)	N/A	HBB:c.194delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70918
3854	CD 66/67 (-AAAG)	N/A	HBB:c.199_202delAAAG	β	Causative	β-thalassaemia	NG_000007.3	70923
2188	CD 66 -A	N/A	HBB:c.201delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70925
175	CD 67 (-TG)	N/A	HBB:c.203_204delGT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70927
3019	CD 68-70 (-7bp): (-TCGGTGC)	N/A	HBB:c.206_212delTCGGTGC	β	Causative	β-thalassaemia	NG_000007.3	70930
2522	CD 69 GGT>G-T	N/A	HBB:c.209delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70933
2189	CD 69 -T	N/A	HBB:c.210delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70934
2462	CD 71 -T	N/A	HBB:c.216delT	β	Causative	β-thalassaemia	NG_000007.3	70940
178	CD 72-73 (-AGTGA, +T)	N/A	HBB: c.217_221delAGTGAinsT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
1044	CD 74-76 (-GCCTGG)	Hb Saint-Antoine	HBB:c.224_229delGCCTGG	β	Causative	β-chain variant	NG_000007.3	70948
179	CD 75 (-C)	N/A	HBB:c.226delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70950
1049	CD 75 (-CTG)	Hb Vicksburg	HBB:c.226_228delCTG	β	Causative	β-chain variant	NG_000007.3	70950
1050	CD 75 CTG>CCG; CD 141 (-CTG)	Hb Atlanta-Coventry	HBB:c.[227T>C;424_426delCTG]	β	Causative	β-chain variant	NG_000007.3	70951
180	CD 76 GCT>--T (-GC)	N/A	HBB:c.229_230delGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70953
181	CD 76 (-C)	N/A	HBB:c.230delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70954
182	CD 78 CTG>-TG	N/A	HBB:c.235delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70959
3225	CD 78/85 (-20bp)	N/A	HBB:c.237_256delGGACAACCTCAAGGGCACCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70961
2445	CD 80 -AAC [-Asn]	Hb Saint-Chamond	HBB:c.241_243delAAC	β	Causative	β-chain variant	NG_000007.3	70965
183	CD 80/81 (-C)	N/A	HBB:c.244delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
184	CD 81-87 (-22 bp)	N/A	HBB:c.244_265del22	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
185	CD 82/83 (-G)	N/A	HBB:c.251delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70975
186	CD 84-86 (-8 bp): (-CACCTTTG)	N/A	HBB:c.253_260del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70977
3965	CD 84-87 (-CTTTGCCACA) (+TTTTTCTCAG) (Hb Donguan-Dongcheng)	Hb Wanjiang	HBB:c.255_264delinsTTTTTCTCAG	β	Causative	β-chain variant	NG_000007.3	70979
3722	CD 86 GCC>GC-	N/A	HBB:c.261delC	β	Causative	β-thalassaemia	NG_000007.3	70985
1087	CD 87 (-ACA)	Hb Tours	HBB:c.262_264delACA	β	Causative	β-chain variant	NG_000007.3	70986
4044	CD 87-91 (-14 bp)	N/A	HBB:c.263_276del	β	Causative	β-thalassaemia	NG_000007.3	70987
3253	CD 88 CTG>--G (HBB:c.265_266delCT)	N/A	HBB:c.265_266del	β	Causative	β-thalassaemia	NG_000007.3	70989
190	CD 88 (-TG)	N/A	HBB:c.266_267del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
3287	CD 89-93 (-14bp): (-AGTGAGCTGCACTG)	N/A	HBB:c.268_281delAGTGAGCTGCACTG	β	Causative	β-thalassaemia	NG_000007.3	70992
191	CD 89/90 (AGTGAG>AGAG)	N/A	HBB:c.270_271del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70994
2965	CD 89-90 (-TGAG)	Hb Wilde	HBB:c.270_273delTGAG	β	Causative	β-chain variant	NG_000007.3	70994
3044	CD 90 GAG>-AG	N/A	HBB:c.271delG	β	Causative	β-thalassaemia	NG_000007.3	70995
193	CD 91 CTG>C-G	Hb Morgantown	HBB:c.275del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
1100	CD 93-97 (-15 bp)	Hb Gun Hill \| Hb GH	HBB:c.280_294delTGTGACAAGCTGCAC	β	Causative	β-chain variant	NG_000007.3	71004
1125	CD 97/98 (-ACG)	Hb Galicia	HBB:c.293_295delACG	β	Causative	β-chain variant	NG_000007.3	71017
3636	CD 104 (-A)	N/A	HBB:c.313delA	β	Causative	β-thalassaemia	NG_000007.3	71037
199	IVS II-1 (-G)	N/A	HBB:c.315+1delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
205	IVS II-2 (-T)	N/A	HBB:c.315+2del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
206	IVS II-2/3 (-2 bp, +11 bp) (IVS II-2,3 (+11/-2))	N/A	HBB:c.315+2_315+3delinsACGTTCTCTGA	β	Causative	β-thalassaemia	NG_000007.3	71041
2182	IVS II-2 -TGAGTCTATGGG	N/A	HBB:c.315+2_315+13delTGAGTCTATGGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
207	IVS II 4/5 -AG	N/A	NG_000007.3:g.71043_71044delAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71043
3247	IVS II-209 (-TTTT)	N/A	HBB:c.315+209_315+212delTTTT	β	Neutral	N/A	NG_000007.3	71248
3683	IVS II-308 (-A)	N/A	HBB:c.315+308delA	β	Causative	β-thalassaemia	NG_000007.3	71347
3797	IVS II-509 (-A)	N/A	HBB:c.316-342delA	β	Causative	β-thalassaemia	NG_000007.3	71548
3391	IVS II-648/649 (-T)	N/A	HBB:c.316-202del	β	Causative	β-thalassaemia	NG_000007.3	71688
3866	IVS II-659_664 (-GCAATA)	N/A	HBB:c.316-192_187del	β	Causative	β-thalassaemia	NG_000007.3	71698
3616	IVS II-809 (-G)	N/A	HBB:c.316-42delG	β	Causative	β-thalassaemia	NG_000007.3	71848
3045	IVS II-848 C>T	N/A	HBB: c.316-3C>T	β	Causative	β-thalassaemia	NG_000007.3	71887
228	IVS II-850 (-G)	N/A	HBB:c.316-1delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
2191	CD 107-111 (-12 bp): (-GCAACGTGCTGG)	N/A	HBB:c.323_334del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
232	CD 108-112 (-12 bp) Asn-Val-Leu-Val-Cys to Ser	N/A	HBB:c.326_337delACGTGCTGGTCT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71900
233	CD 109 (-G) >156aa	Hb Manhattan	HBB:c.328delG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71902
3024	CD 111-115 (-12bp): (-TCTGTGTGCTGG)	N/A	HBB:c.335_346del	β	Causative	β-thalassaemia	NG_000007.3	71909
236	CD 113 (-G) >156aa	N/A	HBB:c.340delG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71914
238	CD 114 (-CT, +G) >156aa	Hb Geneva	HBB:c.343_344delinsG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71917
3308	CD 115-116 (-CC, +G) >156aa	Hb Grand Junction	HBB:c.348_349delinsG	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	71922
3228	CD 116 CAT>-AT	N/A	HBB:c.349del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71923
2193	CD 117 -C	N/A	HBB:c.354delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71928
3846	CD 118 (-TT)	N/A	HBB:c.356_357delTT	β	Causative	β-thalassaemia	NG_000007.3	71930
241	CD 118 (-T) > 156aa	Hb Sainte Seve	HBB:c.357delT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71931
242	CD 120 -A [156 aa] (CD 120 AAA>AA-)	Hb Filottrano	HBB:c.363delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71937
245	CD 123 (-A) >156aa	Hb Makabe	HBB:c.370delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71944
246	CD 123-125 (-ACCCCACC) >135aa	Hb Khon Kaen	HBB:c.370_378delACCCCACCA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71944
4065	CD 124 (-C)	N/A	HBB:c.374delC	β	Causative	α-thalassaemia	NG_000007.3	71948
247	CD 124 (-A) >156aa	N/A	HBB:c.375delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
2195	CD 125-127 (-CAGTGC)	N/A	HBB:c.377_382delCAGTGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71951
249	CD 125 (-A) >156aa	N/A	HBB:c.378delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71952
250	CD 126 (-T) >156aa	Hb Vercelli	HBB:c.380delT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71954
252	CD 126-131 (-17 bp)	Hb Westdale	HBB:c.380_396delTGCAGGCTGCCTATCAG	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	71954
4087	CD 128-134 (-21bp): (-CAGGCTGCCTATCAGAAAGTG)	N/A	HBB:c.382_402del	β	Causative	β-thalassaemia	NG_000007.3	71956
256	CD 127/128 -AGG [Glu-Ala>Pro]	Hb Gunma	HBB:c.383_385delAGG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71957
257	CD 128/129 (-4, +5, -11 bp) >153aa	N/A	HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71959
3927	CD 128 GCT>-CT	N/A	HBB:c.385delG	β	Causative	β-thalassaemia	NG_000007.3	71959
3951	CD 129-133 (-CCTATCAGAAAGT)	Hb Phoenix	HBB:c.389_401del	β	Causative	β-chain variant	NG_000007.3	71963
260	CD 131-132 (-GA) >138aa	N/A	HBB:c.396_397delGA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
261	CD 131-134 (-11bp) >134aa	N/A	HBB:c.396_406del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
3896	CD 132 (AAA>AA-)	N/A	HBB:c.399del	β	Causative	β-thalassaemia	NG_000007.3	71973
263	CD 134-137 (-12, +6 bp) Val-Ala-Gly-Val to Gly-Arg	N/A	HBB:c.404_413delinsGCAG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71978
3249	CD 135 GCT>GC-	Hb Urumqi	HBB:c.408delT	β	Causative	β-chain variant, Haemolytic anaemia	NG_000007.3	71982
264	CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp	Hb Stara Zagora	HBB:c.413_418delTGGCTA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71987
265	CD 141 (-C) >156aa	Hb Florida	HBB:c.424delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71998
1287	CD 141 (-CTG)	Hb Coventry	HBB:c.424_426delCTG	β	Causative	β-chain variant	NG_000007.3	71998
1288	CD 141-144 (-TGGCCCACA)	Hb Birmingham	HBB:c.425_433delTGGCCCACA	β	Causative	β-chain variant	NG_000007.3	71999
1290	CD 142 (-CC)	Hb Uzes	HBB:c.429_430delCC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72003
2024	CD 143 (-C)	Hb Montreal II	HBB:c.430delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72004
1294	CD 143 (-A)	Hb Saverne	HBB:c.431delA	β	Causative	β-chain variant	NG_000007.3	72005
1302	CD 144 (-A)	Hb Trento	HBB:c.434delA	β	Causative	β-chain variant	NG_000007.3	72008
3048	3'UTR, +C, -TGGATTCT	N/A	HBB:c.96_103delTGGATTCTinsC	β	Causative	β-thalassaemia	NG_000007.3	72113
277	Poly A (-TA); (AATAAA>AAAA)	N/A	HBB:c.110_111delTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
278	Poly A (-AATAA) (polyA (-TAAAA))	N/A	HBB:c.110_114del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
4025	Poly A (-T) AATAAA>AA-AAA	N/A	HBB:c.*110del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
3046	3'UTR +115-+116 (-AA) (Poly A (-AA))	N/A	HBB:c.115_116del	β	Causative	β-thalassaemia	NG_000007.3	72133
2819	rs45606437	N/A	NG_011968.1:g.62525delG	BCL11A	Modifier	Hb F levels	NG_011968.1	62525
2840	rs66650371	N/A	NC_000006.12:g.135097495_135097497delTAC	HBS1L-MYB	Modifier	Hb F levels, Abnormal platelet count, Abnormal white blood cell count, Abnormal red blood cell count, Anaemia	NT_025741.15
2076	CD 54-57 (-11bp): (-GAAGTCTGAGG)	N/A	NG_013087.1:g.6133_6143delGAAGTCTGAGG	KLF1	Modifier	Hb F levels	NG_013087.1	6133
3091	CD 290/293 (-12bp) or CD 290/294 (-12bp)	N/A	NG_013087.1:g.6842_6853delTACACCAAGAGC \| NG_013087.1:g.6843_6854delACACCAAGAGCT	KLF1	Modifier	Hb F levels	NG_013087.1	6842, 6843
2087	IVS II-252_255 (-4bp): (-CTAG)	N/A	NG_013087.1:g.7140_7143delCTAG	KLF1	Modifier	Hb F levels	NG_013087.1	7140
3486	CD 314 GAA>GA- (c.942delA)	N/A	NG_013087.1:g.7172delA	KLF1	Modifier	Hb F levels	NG_013087.1	7172
2517	CD 328 CGC>-GC	N/A	NG_013087.1:g.7212delC	KLF1	Modifier	Anaemia	NG_013087.1	7212
3332	rs4025935	N/A	NG_009246.1:g.4023_4024delTG	GSTM1	Modifier	Cardiac iron load, Anaemia	NG_009246.1	4023
3206	rs71785313 (APOL1 G2)	N/A	NG_023228.1:g.17930_17935delTTATAA	APOL1	Modifier	Abnormal GFR, Proteinuria, Albuminuria	NG_023228.1	17930
2784	rs55659002 (713-8delC)	N/A	NG_013364.1:g.16889delC	TGFB1	Modifier	Osteoporosis	NG_013364.1	16889
3085	rs200434923	N/A	NG_012856.2:g.45214_45218delCCCCA	TMPRSS6	Modifier	Abnormal hepcidin level	NG_012856.2	45214
3979	PUM1:p.H1090Pfs*16	N/A	NC_000001.11:g.30936810_30936813del, NM_001020658.2(PUM1):c.3267_3270del	PUM1	Modifier	Hb F levels	N/A
3536	rs1479076497	N/A	NC_000010.11:g.70151278_70151284del	SAR1A	Modifier	Response to hydroxyurea	NM_001142648.2
3537	rs1180306451	N/A	NC_000010.11:g.70151277_70151284del	SAR1A	Modifier	Response to hydroxyurea	NM_001142648.2
3540	rs1482813291	N/A	NC_000010.11:g.70151276_70151284del	SAR1A	Modifier	Response to hydroxyurea	NM_001142648.2	0

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.