Loading... Please wait!
Quick filtering
Showing all entries assigned as Thalassaemia (Show All):
| IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
|---|---|---|---|---|---|---|---|---|
| 2252 | --BR | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 3407 | (αα)JS | N/A | NC_000016.9:g.96621_176318del | HS40, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 3408 | --60.2 | N/A | NC_000016.9:g.197577_257872del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 3588 | --OY | N/A | NC_000016.10:g.0_318539del | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
| 301 | -α4.2 | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 302 | -α2.4 | N/A | N/A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 306 | -α7.9 | N/A | N/A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 307 | -α18 (18 kb deletion) | N/A | N/A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 316 | -(α)5.2 | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 322 | --CI (28+ kb deletion.) | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 324 | --115 | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 326 | --YEM | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 329 | --KOL | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 330 | --11.1 (11.1 kb deletion) | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 331 | --OH | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 332 | (αα)RA | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 333 | (αα)TI | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 334 | (αα)IJ | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 335 | (αα)CMO | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 336 | (αα)TAT | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 337 | (αα)MB | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 338 | (αα)IC | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 339 | (αα)IdF | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2230 | -α3.7 (type II) | N/A | N/A | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2231 | -α3.7 (type III) | N/A | N/A | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2233 | -ζ | N/A | N/A | ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2234 | -α16.6 | N/A | N/A | ζ, α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2235 | α-αΔ970 (970 bp deletion) | N/A | N/A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2236 | --DUTCH I | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2237 | --AW | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2238 | --BGS | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2239 | --CAMPANIA | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2240 | --FIL-2 (27.9 deletion) | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2241 | --ED | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2242 | --GP | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2243 | (αα)AS | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2244 | (αα)JM | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2245 | (αα)MM | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2246 | (αα)L | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2247 | (αα)SN | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2248 | (αα)Sco | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2249 | (αα)ZW | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2250 | (αα)RSR | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2251 | (αα)MCu | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2253 | --ZW | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2254 | --JY | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2255 | --LC | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2256 | --VR | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2257 | --JT | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2258 | --AB | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2259 | --GZ | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2260 | Dutch II | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2261 | --MK | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2262 | --80 | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2263 | α-ZF | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2264 | --Brazil | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2265 | --PV | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2266 | --HN | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2267 | --FT | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2268 | --BA | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2269 | --TN | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2270 | --BO | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2271 | --IM | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2272 | --LIN | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2273 | --GS | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2555 | α12 (HBA2 gene conversion) | N/A | N/A | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 2562 | (αα)HS40del (hg19 chr16:g.(?_103625)_(163701_193676)del) | N/A | chr16:g.(?_103,625)_163,701_193,676)del | HS40 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 2567 | BS duplication | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 2568 | FD duplication | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 2570 | Sardinian duplication | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3021 | --JAL | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3022 | --LOD | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3067 | --MEX1 | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3068 | --MEX2 | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3070 | αααα282 | N/A | N/A | HS40, ζ, α2, α1, NPRL3 | Causative | β-thalassaemia | NG_000006.1 | 0 |
| 3071 | --235 | N/A | N/A | HS40, ζ, α2, α1, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3074 | (αα)JX | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3076 | αααα391 | N/A | N/A | HS40, ζ, α2, α1 | Causative | β-thalassaemia | NG_000006.1 | 0 |
| 3142 | -α6.3 | N/A | NG_000006.1:g.31022_37366del6344 | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3214 | 44.6 kb deletion | N/A | NC_000016.9:g.194214_238840del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3215 | --Braz | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3244 | −KOZANI | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3255 | --MEX3 | N/A | NC_000016.10:g.151479_182582del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3258 | --NFLD | N/A | NC_000016.10:g.169197_259919delinsCACCCAGCACCCAGTACCA | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3265 | α-globin cluster triplication | N/A | N/A | HS40, ζ, α2, α1, HBM | Causative | β-thalassaemia | NG_000006.1 | 0 |
| 3273 | --VS | N/A | N/A | HS40, ζ, α2, α1, HBM, AXIN1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3274 | --CBR | N/A | N/A | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3275 | (αα)ALT | N/A | N/A | HS40 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3283 | --JS | N/A | N/A | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3284 | --PG | N/A | NG_000006.1:g.93628_542759del450131 | HS40, ζ, α2, α1, NPRL3, HBM, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3292 | 15 kb deletion | N/A | N/A | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3293 | 97 kb deletion | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3294 | 22 kb deletion | N/A | N/A | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3295 | 225 kb deletion | N/A | N/A | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3296 | --GB | N/A | N/A | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3327 | --GX | N/A | N/A | HS40, ζ, α2, α1, NPRL3, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
| 3440 | -αMAL3.5 | N/A | NG_000006.1:g.32745_36301del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3514 | 170 kb deletion | N/A | N/A | α2, α1, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 327 | --MC | N/A | NG_000006.1:g.164_43364del43201 | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 164 |
| 3595 | --CR | Hb Chiang Rai | NC_000016.10:g.144215_188843del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 5078 |
| 2554 | -α28.5 | N/A | NG_000006.1g.7065_35627del28563 | ζ, α2 | Causative | α-thalassaemia | NG_000006.1 | 7065 |
| 323 | --CAL | N/A | NG_000006.1:g.8464_40664del32201 | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8464 |
| 313 | --MED II | N/A | N/A | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8726 |
| 3020 | --DANE | N/A | NG_000006.1: g.8800_40007del31208 | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 8800 |
| 2232 | -α27.6 | N/A | NG_000006.1:g.9079_36718del27640 | ζ, α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 9079 |
| 310 | --THAI | N/A | NC_000016.10:g.149863_183312del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 10726 |
| 325 | --RT | N/A | NG_000006.1:g.12264_49164del36901 | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12264 |
| 311 | --FIL | N/A | NC_000016.10:g.151641_182316del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12504 |
| 321 | --CL | N/A | NG_000006.1:g.13314_124664del111351 | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 13314 |
| 2475 | 21.9 kb deletion with 29 bp insertion (Qinzhou type deletion) | N/A | NG_000006.1:g.[14373_36299del21927; insGGGAAGGGTGGGTGGGAATAACAGCTTTT] | ζ, α2 | Causative | α-thalassaemia | NG_000006.1 | 14373 |
| 320 | --BRIT | N/A | NG_000006.1:g.16364_45664del29301 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 16364 |
| 314 | -(α)20.5 | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18200 |
| 319 | --MA | N/A | NG_000006.1:g.18964_39864del20901 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18964 |
| 315 | --SA | N/A | NG_000006.1:g.19464_43064del23601 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 19464 |
| 312 | --MED I | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 23662 |
| 309 | --SEA | N/A | NG_000006.1:g.26264_45564del19301 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 26264 |
| 305 | -α5.3 | N/A | NG_000006.1:g.28684_33930del5246 | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 28684 |
| 328 | --CANT | N/A | NC_000016.10:g.(168531_169756)_(182770_183028)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 29394 |
| 3603 | -α6.9 (The deletion spans approximately 6.9 kb on the alpha-globin gene cluster, removing the α2 gene but leaving the α1 gene intact. The 5' deletion breakpoint lies in the HBAP1 gene. Deletion breakpoints were determined by MLPA and Gap-PCR analyses. Reported in a compound heterozygous state with --SEA deletion in a proband presenting with HbH disease.) | N/A | NG_000006.1:g.29785_36746del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 29785 |
| 318 | --SPAN | N/A | NC_000016.10:g.(169756_170100)_(179044_181595)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 30619 |
| 3018 | --NOR | N/A | NC_000016.10:g.170678_184085del | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 31541 |
| 3360 | 9.7 kb deletion | N/A | NG_000006.1:g.32709_42418del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32709 |
| 317 | --GEO | N/A | NG_000006.1:g.32864_42264del9401 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32864 |
| 3268 | 811 bp deletion | N/A | NG_000006.1:g.32945_33755 | α2 | Causative | α-thalassaemia | NG_000006.1 | 32945 |
| 2988 | -54 G>A | N/A | HBA2:c.-91G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33685 |
| 2967 | -22 C>T | N/A | HBA2:c.-59C>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33717 |
| 346 | Init CD ACCATG>--CATG | N/A | HBA2:c.-3delAC | α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33773 |
| 3051 | Init CD ACCATG>-CCATG | N/A | HBA2:c.-3delA | α2 | Causative | α-thalassaemia | NG_000006.1 | 33773 |
| 344 | Init CD ATG>-TG | N/A | HBA2:c.1delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33776 |
| 345 | Init CD ATG>GTG | N/A | HBA2:c.1A>G | α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33776 |
| 3050 | Init CD ATG>TTG [Met>Leu] | N/A | HBA2:c.1A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33776 |
| 342 | Init CD ATG>ACG [Met>Thr] | N/A | HBA2:c.2T>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
| 343 | Init CD ATG>A-G | N/A | HBA2:c.2delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
| 2460 | Init CD ATG>AGG [Met>Arg] | N/A | HBA2:c.2T>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
| 3564 | Init CD ATG>ATC [Met>Ile] | N/A | HBA2:c.3G>C | α2 | Causative | α-thalassaemia | NG_000006.1 | 33778 |
| 2469 | CD 7 AAG>TAG | N/A | HBA2:c.22A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33797 |
| 3599 | CD 13 GCC>TCC [Ala>Ser] | N/A | HBA2:c.40G>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33815 |
| 2518 | CD 14 TGG>TGA | N/A | HBA2:c.45G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33820 |
| 350 | CD 18 GGC>G-C | N/A | HBA2:c.56delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33831 |
| 2465 | CD 19 GCG>GC- | N/A | HBA2:c.60delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33835 |
| 2207 | CD 21/22 +T | N/A | HBA2:c.66_67insT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33841 |
| 352 | CD 22 GGC>GGT new donor consensus | N/A | HBA2:c.69C>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
| 353 | CD 22 -C | N/A | HBA2:c.69delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
| 354 | CD 23 GAG>TAG | N/A | HBA2:c.70G>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33845 |
| 2208 | CD 24 TAT>TAG | N/A | HBA2:c.75T>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33850 |
| 2488 | CD 24 TAT>TAA | N/A | HBA2:c.75T>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33850 |
| 3568 | CD 28 GCC>-CC | N/A | HBA2:c.85delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33860 |
| 357 | CD 30 -GAG [-Glu] | N/A | HBA2:c.91_93delGAG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33866 |
| 2210 | CD 31 AGG>CGG [Arg>Arg] | N/A | HBA2:c.94A>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33869 |
| 366 | CD 31 AGG>AAG [Arg>Lys] | N/A | HBA2:c.95G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33870 |
| 2483 | IVS I-1 G>T | N/A | HBA2:c.95+1G>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33871 |
| 359 | IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor (α-5nt) | N/A | HBA2:c.95+2_95+6delTGAGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33872 |
| 360 | IVS I-5 G>A | N/A | HBA2:c.95+5 G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33875 |
| 362 | IVS I-55 G>A | N/A | HBA2:c.95+55 G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33925 |
| 363 | IVS I-116 GCAGGA>GCGGGA acceptor | N/A | HBA2:c.96-2A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33986 |
| 2957 | IVS I-117 G>A | N/A | HBA2:c.96-1G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33987 |
| 2211 | CD 37 -C | N/A | HBA2:c.112delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34004 |
| 3052 | CD 37 CCC>CC- | N/A | HBA2:c.114delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34006 |
| 372 | CD 39-41 (-9 bp, + 8 bp) | N/A | NG_000006.1:g.34010_34018delinsTACTTCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34010 |
| 2493 | CD 40 AAG>AA- | N/A | HBA2:c.123delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34015 |
| 2213 | CD 43 TTC>-TC | N/A | HBA2:c.130delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34022 |
| 2214 | CD 43 TTC>T-C | N/A | HBA2:c.131delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34023 |
| 2215 | CD 43/44 -C | N/A | HBA2:c.132delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34024 |
| 3405 | CD 47-53 (-24bp): (-GACCTGAGCCACGGCTCTGC) | N/A | HBA2:c.142_161delGACCTGAGCCACGGCTCTGC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34034 |
| 2216 | CD 47 -A | N/A | HBA2:c.143delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34035 |
| 3053 | CD 47/48 (-4bp): (-ACCT) | N/A | HBA2:c.143_146delACCT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34035 |
| 374 | CD 49 -GC | N/A | HBA2:c.149_150delGC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34041 |
| 2217 | CD 51/52 +G | N/A | HBA2:c.156_157insG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34048 |
| 376 | CD 54 (CAG>TAG) | N/A | HBA2:c.163C>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34055 |
| 3079 | CD 55 +T | N/A | HBA2:c.168dup | α2 | Causative | α-thalassaemia | NG_000006.1 | 34060 |
| 3054 | CD 56 AAG>--G | N/A | HBA2:c.169_170delAA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34061 |
| 3286 | CD 61 AAG>TAG [Lys>STOP] | N/A | HBA2:c.184A>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34076 |
| 2218 | CD 63-76 (-42 bp) | N/A | HBA2:c.190_231del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34082 |
| 2576 | CD 68 AAC>A-C | N/A | HBA2:c.206delA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34098 |
| 3055 | CD 73/74 (-4bp): (-GTGG) | N/A | HBA2:c.220_223delGTGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34112 |
| 3569 | CD 89-93 (-13bp): (-CACAAGCTTCGGG) | N/A | HBA2:c.268_280delCACAAGCTTCGGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34160 |
| 388 | CD 90 AAG>TAG | N/A | HBA2:c.271A>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34163 |
| 300 | -α3.7 (type I) (-α3.7) | N/A | NG_000006.1:g.34164_37967del3804 | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34164 |
| 3572 | CD 90‐93 (-8bp): (‐AGCTTCGG) | N/A | HBA2:c.272_279delAGCTTCGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34164 |
| 3080 | CD 94 (+21 bp duplication) | Hb SKMC | HBA2:c.283_300+3dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34175 |
| 391 | IVS II-2 GT>GA donor | N/A | HBA2:c.300+2T>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34194 |
| 2430 | 203 bp deletion | N/A | NG_000006.1:g.34305_34507del203 | α2 | Causative | α-thalassaemia | NG_000006.1 | 34305 |
| 392 | IVS II-142 G>A | N/A | HBA2:c.301-1G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 34334 |
| 398 | CD 108 -C | N/A | HBA1:c.327delC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34361 |
| 402 | CD 112/113 -C | N/A | HBA2:c.339delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34373 |
| 403 | CD 113/114 -C | N/A | HBA2:c.342delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34376 |
| 3078 | CD 113 +CC | N/A | HBA2:c.342_345insCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34376 |
| 3140 | CD 114 CCC>CC- | N/A | HBA2:c.345delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34379 |
| 405 | CD 116 GAG>TAG | N/A | HBA2:c.349G>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
| 2221 | CD 115 -GAGTTCACCCC [166 aa] | N/A | HBA2:c.349_359delGAGTTCACCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
| 410 | CD 125 CTG>CAG [Leu>Gln] | Hb Weste-Einde | HBA2:c.377T>A | α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34411 |
| 3305 | CD 126 GCG>-CG | N/A | HBA2:c.379delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34413 |
| 2519 | CD 127 AAG>TAG [Lys>STOP] | N/A | HBA2:c.382A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 34416 |
| 2226 | 3' UTR +46 C>A | N/A | HBA2:c.*46C>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34509 |
| 428 | 3' UTR -16 bp (giving rise to CATAAA) | N/A | HBA2:c.*74_*89delCCTTCCTGGTCTTTGA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34537 |
| 425 | Poly(A) AATAAA>AATGAA (αPolyA2) | N/A | HBA2:c.*92A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34555 |
| 426 | Poly(A) AATAAA>AATA-- | N/A | HBA2:c.*93_*94delAA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34556 |
| 424 | Poly(A) AATAAA>AATAAG (αPolyA1 , αT-Saudi) | N/A | HBA2:c.*94A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34557 |
| 427 | Poly(A) AATAAA>AATAAC | N/A | HBA2:c.*94A>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34557 |
| 303 | -α2.7 | N/A | NG_000006.1:g.36664_39364del2701 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 36664 |
| 304 | -α3.5 | N/A | NG_000006.1:g.37464_40964del3501 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37464 |
| 340 | CAP +22 T>C | N/A | HBA1:c.-16T>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37564 |
| 2203 | CAP +29 (G>C) | N/A | HBA1:c.-9G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37571 |
| 341 | Init CD ATG>GTG | N/A | HBA1:c.1A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37580 |
| 3147 | Init CD ATG>AAG [Met>Lys] | N/A | HBA1:c.2T>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37581 |
| 3250 | Init CD ATG>A-G | N/A | HBA1:c.2delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37581 |
| 349 | CD 14 TGG>TAG | N/A | HBA1:c.44A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37623 |
| 3395 | CD 16 AAG>TAG [Lys>STOP] | N/A | HBA1:c.49A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37628 |
| 3266 | CD 22 GGC>GGT [Gly>Gly] | N/A | HBA1:c.69C>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37648 |
| 3267 | CD 23 GAG>TAG | N/A | HBA1:c.70G>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37649 |
| 3032 | CD 28 GCC>TCC [Ala>Ser] | N/A | HBA1:c.85G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37664 |
| 3030 | CD 30 GAG>TAG | N/A | HBA1:c.91G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37670 |
| 365 | CD 31 AGG>--G | N/A | HBA1:c.92_93delAG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37673 |
| 2417 | CD 31 AGG>--G | N/A | HBA1:c.94_95delAG | HBA2:c.94_95delAG | α3.7 hybrid | Causative | α-thalassaemia | NG_000006.1 | 37673 |
| 358 | IVS I-1 AGGT>AGAT donor | N/A | HBA1:c.95+1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37675 |
| 3049 | IVS I-1 AGGT>AGCT donor | N/A | HBA1:c.95+1G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37675 |
| 2204 | IVS I-4 A>G | N/A | HBA1:c.95+4A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37678 |
| 361 | IVS I-5 G>A | N/A | HBA1:c.95+5 G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37679 |
| 3431 | IVS I-38 C>T | N/A | HBA1:c.95+38C>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37712 |
| 2212 | IVS I-45 G>C | N/A | HBA1:c.95+45G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37719 |
| 2451 | IVS I-116 A>G | N/A | HBA1:c.96-2A>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37790 |
| 364 | IVS I-117 GCAGGA>GCAAGA acceptor | N/A | HBA1:c.96-1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37791 |
| 3251 | IVS I-117 GCAGGA>GCACGA acceptor | N/A | HBA1:c.96-1G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37791 |
| 3403 | CD 39 +A | N/A | HBA2:c.118_119insA | α2 | Causative | α-thalassaemia | NG_000006.1 | 37814 |
| 2468 | CD 44 +C | N/A | HBA1:c.134_135insC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37830 |
| 375 | CD 51-55 (-13 bp deletion) | N/A | HBA1:c.155_167delGCTCTGCCCAGGT | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37851 |
| 3334 | CD 61 AAG>TAG [Lys>STOP] | N/A | HBA1:c.184A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37880 |
| 2429 | CD 62 GTG>GCG [Val>Ala] | N/A | HBA1:c.188T>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37884 |
| 2347 | CD 62 -G | N/A | HBA1:c.189delG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37885 |
| 3373 | CD 67 ACC>-CC | N/A | HBA1:c.202delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37898 |
| 385 | CD 74/75 -GAC [- Asp] | N/A | HBA1:c.212_214delGAC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37908 |
| 3326 | CD 73 GTG>G-G | N/A | HBA1:c.221delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37917 |
| 386 | CD 78 -C | N/A | HBA1:c.237delC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37933 |
| 2219 | CD 81 -T | N/A | HBA2:c.244delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37940 |
| 387 | CD 82/83/84 del 5bp ins | N/A | HBA1:c.247_255delGCCCTGAGC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37943 |
| 390 | CD 93-99 (+21 bp) | N/A | HBA1:c.280_300ins21 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37976 |
| 2467 | CD 99 AAG>TAG | N/A | HBA1:c.298A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37994 |
| 3031 | IVS II-1 G>A | N/A | HBA1:c.300+1G>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 37997 |
| 2222 | IVS II-147 C>G | N/A | HBA1:c.301-3C>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38142 |
| 393 | IVS II-148 A>G consensus | N/A | HBA1:c.301-2A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38143 |
| 2224 | CD 110-114 (-13 bp) | N/A | HBA1:c.333_345delCGCCCACCTCCCC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38178 |
| 2225 | Poly A (G>A) AATAAAG>AATAAAA | N/A | HBA1:c.*96G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38370 |
| 284 | 468 bp deletion | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | |
| 2159 | (εγδβ)0 with α triplication | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | |
| 3393 | 3.5 kb deletion (Thai, 3485 bp deletion) | N/A | NC_000011.10:g.5224302-5227791del3490bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | |
| 3570 | 1.78Mb εγδβ(0) del (Bedouin) | N/A | NC_000011.10:g.(4302665_4322227)_(6099443_6100105)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
| 3578 | 2.2 Mb deletion | N/A | NC_000011.10:g.4052720_6253287del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
| 290 | Thai (3485 bp deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 291 | Czech (4237 bp deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 292 | Turk (~7.6 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 293 | Cape Verdean | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 294 | Asian Indian (10329 bp deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 295 | Australian (Anglo Saxon) (12023 bp deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 299 | Italian (~67 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 1400 | Hb Lepore-Leiden | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 | |
| 1511 | East European (δβ)0 | N/A | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1512 | Laotian (δβ)0 | N/A | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1514 | Macedonian/Turkish (δβ)0 (Turkish type 2 (δβ)0 | Turkish Inv/Del (δβ)0) | N/A | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1515 | Turkish (δβ)0 (Turkish type 3 (δβ)0) | N/A | N/A | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1516 | Leiden 7.4 kb (δβ)0 | N/A | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1517 | Thai 11.3 (δβ)0 | N/A | N/A | δ, β | Causative | δβ-thalassaemia, Hb F levels | NG_000007.3 | 0 |
| 1518 | Japanese 2 (δβ)0 | N/A | N/A | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1519 | Indian (Aγδβ)0 (inv) (Asian-Indian Inv/Del Gγ(Aγδβ)0) | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1521 | Cantonese (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1522 | Malaysian-1 (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1525 | Belgian (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1528 | Yunnanese (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1530 | Italian (Aγδβ)0 | N/A | NC_000011.9:g.(5215685_5215688)_(5270743_5270746)del55059 | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1531 | Canadian (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1532 | Leiden 69.5 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1533 | 49.3 kb Gγ(Aγδβ)0 Asian del | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
| 1534 | Anglo-Saxon (εγδβ)0 | N/A | NC_000011.8:g.5204501_5300223del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1535 | Irish (εγδβ)0 | N/A | NC_000011.8:g.5110112_5312961del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1536 | Canadian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1537 | Scottish - Irish | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1538 | English I (εγδβ)0 | N/A | N/A | βLCR, ε, Gγ | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1539 | Mexican (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1540 | Hispanic (εγδβ)0 | N/A | NC_000011.8:g.5257379_5297161del | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1541 | Croatian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1542 | Dutch I (εγδβ)0 | N/A | NC_000011.8:g.5207238_5307069del99611 | βLCR, ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 0 |
| 1543 | English II | N/A | N/A | βLCR, ε | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1544 | English III | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1545 | English IV | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1546 | Chilean | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1547 | Dutch II | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B5, OR51M1 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1548 | Dutch III | N/A | N/A | βLCR, ε, Aγ, Gγ | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1549 | Dutch IV | N/A | N/A | βLCR, ε, Aγ, Gγ, OR51B5, OR51B6 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1550 | Dutch V | N/A | N/A | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1551 | Dutch VI | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1552 | Japanese | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 1553 | French | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 2123 | 7719 bp deletion | N/A | NG_000007.3:g.71550_79270del7719 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 2126 | South East Asian (SEA) deletion (27 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 2158 | Pakistani I | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 2161 | French (εγδβ)0 insertion/deletion | N/A | N/A | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 2163 | Norwegian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 2164 | Tennessean (εγδβ)0 | N/A | N/A | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 2165 | Puerto Rican (εγδβ)0 | N/A | N/A | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 2167 | Asian Indian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 2418 | Swiss (εγδβ)0 | N/A | NC_000011.9:g.(4023964_4024014)_(6928943_6928993)del2904980 | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 0 |
| 2419 | Senegalese δ(0)β(+) | N/A | NG_000007.3:g.(63154_63209)_(70570_70625)del7417 | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 0 |
| 2548 | Inv-Del English V | N/A | NC_000011.10:g.5215690_5274684invdel5215690_5215772del5274684_5397195 | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 2551 | Austrian I | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 3073 | Italian (εγδβ)0 deletion | N/A | NC_000011.10:g.[5194397_5357192del;5194356_5194401insAGCTAAAGGTTTTGTAAATGCACCAATCAGCAATCTGTGTCTAACTC] | ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 3270 | Chinese I (εγδβ)0 | N/A | NC_000011.9:g.5057966_5291566del | ε, Aγ, Gγ, δ, β, pseudo β, OR51V1 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 3340 | Brazilian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B2 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
| 3394 | 223 kb deletion | N/A | NC_000011.9:g.5031238_5254163del | δ, β | Causative | β-thalassaemia | NG_000007.3 | 0 |
| 3577 | 59 Kb deletion | N/A | NC_000011.10:g.5236469_5295261del | βLCR, ε, Aγ, Gγ | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 2355 |
| 2566 | Caribbean | N/A | NG_000007.3:g.8510_13369del | βLCR | Causative | β-thalassaemia | NG_000007.3 | 8510 |
| 1524 | Turkish (Aγδβ)0 | N/A | NG_000007.3:g.45410_81665del36256 | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 45410 |
| 1504 | SE Asian, Thai (Aγδβ)0 (HPFH-6) | N/A | NC_000011.10:g.5172745_5252029 | Aγ, δ, β, pseudo β, OR51V1, OR52Z1-OR51V1 | Causative | δβ-thalassaemia, Hb F levels | NG_000007.3 | 45587 |
| 1520 | German (Aγδβ)0 | N/A | NG_000007.3:g.(45922_46319)_(98640_99640)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 45922 |
| 1523 | Malaysian-2 (Aγδβ)0 | N/A | NG_000007.3:g.(47376_47553)_(89149_90149)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 47376 |
| 1527 | Chinese (Aγδβ)0 | N/A | NG_000007.3:g.48795_127698del78904 | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 48795 |
| 1526 | Black (Aγδβ)0 | N/A | NG_000007.3:g.49040_84889del35850 | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 49040 |
| 1506 | Indian (δβ)0 (32.6 kb GγΑγ(δβ)0 Indian del) | N/A | NG_000007.3:g.50509_83170del32662 | δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 50509 |
| 1508 | Japanese (δβ)0 | N/A | NG_000007.3:g.51483_165148del113666 | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 51483 |
| 110 | IVS I-5 (G>A) + Corfu deletion (7.2 kb Corfu δβ thalassaemia, Corfu (δβ)0) | N/A | NG_000007.3:g.57237_64443del7207; HBB:c.92+5G>A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 57237, 70691 |
| 1497 | Corfu (δ)0 (7.2kb Corfu deletion) | N/A | NG_000007.3:g.57237_64443del7207 | δ | Causative | δ-thalassaemia | NG_000007.3 | 57237 |
| 1509 | Spanish (δβ)0 | N/A | NG_000007.3:g.60375_153285del92911 | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 60375 |
| 1510 | Black (δβ)0 | N/A | NG_000007.3:g.(60530_60730)_(72351_72551)del11822 | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 60530 |
| 3601 | -130 A>G | N/A | HBD:c.-180A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63003 |
| 3223 | CAP +48 (A>T) | N/A | HBD:c.-6A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63019 |
| 2202 | CAP +53 (G>A) | N/A | HBD:c.-1G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63024 |
| 1321 | -80 (G>A) | N/A | HBD:c.-130G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63053 |
| 1322 | -77 (T>C) | N/A | HBD:c.-127T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63056 |
| 1323 | -76 (A>T) | N/A | HBD:c.-126A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63057 |
| 1324 | -68 (C>T) | N/A | HBD:c.-118C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63065 |
| 1325 | -65 (A>G) | N/A | HBD:c.-115A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63068 |
| 1326 | -55 (T>C) | N/A | HBD:c.-105T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63078 |
| 3602 | -44 G>A | N/A | HBD:c.-94G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63089 |
| 1327 | -36 (C>A) | N/A | HBD:c.-86C>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63097 |
| 1328 | -31 (A>G) | N/A | HBD:c.-81A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63102 |
| 1329 | -30 T>C | N/A | HBD:c.-80T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63103 |
| 1330 | Init CD ATG>ATA [Met>Ile] | N/A | HBD:c.3G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63185 |
| 3307 | N/A | Hb Lepore Rochester-MN | NG_000007.3:g.[63191_70603dup;63291_70703del] | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63191 |
| 3231 | CD 7 (-3bp): (-GAG) | N/A | HBD:c.22_24delGAG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63204 |
| 3336 | CD 7 GAG>TAG [Glu>STOP] | N/A | HBD:c.22G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63204 |
| 3232 | CD 10 GCT>-CT | N/A | HBD:c.31delG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63213 |
| 1333 | CD 30 (AGG>ACG) | N/A | HBD:c.92G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63274 |
| 1334 | IVS I-2 (T>C) | N/A | HBD:c.92+2T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63276 |
| 2090 | IVS I-5 G>T | N/A | HBD:c.92+5G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63279 |
| 1397 | Hb Lepore-Hollandia | NG_000007.3:g.63290_70702del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63290 | |
| 2563 | IVS I-1 (27 bp insertion) | N/A | HBD:c.92+83_84ins27 | δ | Causative | δ-thalassaemia | NG_000007.3 | 63357 |
| 3233 | IVS I 3' AG>-C | N/A | HBD:c.93-2delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63401 |
| 1335 | IVS I 3' AG>AC | N/A | HBD:c.93-1G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63402 |
| 1336 | CD 37 (TGG>TAG) | N/A | HBD:c.113G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63423 |
| 2575 | CD 58 +C | N/A | HBD:c.176_177insC | δ | Causative | δ-thalassaemia | NG_000007.3 | 63486 |
| 1337 | CD 59 (-A) | N/A | HBD:c.178delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63488 |
| 3441 | CD 59 AAG>A-G | N/A | HBD:c.179delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63489 |
| 3237 | CD59/60 (+GG) | N/A | HBD:c.180_181dupGG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63490 |
| 2092 | CD 82 AAG>TAG | N/A | NG_000007.3:g.63557A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63557 |
| 1398 | Hb Lepore-Baltimore | NG_000007.3:g.63564_70978del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63564 | |
| 3236 | CD 87 CAG>C-G | N/A | HBD:c.263delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63573 |
| 3598 | CD 93/94 (-TG) [Cys>STOP] | N/A | HBD:c.282_283delTG | δ | Causative | N/A | NG_000007.3 | 63592 |
| 1338 | CD 91 (+T) | N/A | HBD:c.286_287insT | δ | Causative | δ-thalassaemia | NG_000007.3 | 63596 |
| 1340 | IVS II-1 G>A | N/A | HBD:c.315+1G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63626 |
| 1341 | IVS II-6 (T>A) | N/A | HBD:c.315+6T>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63631 |
| 1507 | Sicilian (δβ)0 | N/A | NG_000007.3:g.64336_77738del13403 | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64336 |
| 1513 | Thai/Vietnamese (δβ)0 (Thai (δβ)0 , Vietnamese (δβ)0 ) | N/A | NG_000007.3:g.64384_76993del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64384 |
| 1342 | IVS II-894 C>T | N/A | HBD:c.316-5C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64519 |
| 1343 | IVS II-897 A>C | N/A | HBD:c.316-2A>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 64522 |
| 2473 | IVS II-897 A>G | N/A | HBD:c.316-2A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 64522 |
| 3234 | CD 113 (+TG) | N/A | HBD:c.341_342dupTG | δ | Causative | δ-thalassaemia | NG_000007.3 | 64549 |
| 3230 | CD 115 GCC>GTC [Ala>Val] | N/A | HBD:c.347C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64555 |
| 3229 | CD 116 CGC>GGC [Arg>Gly] | N/A | HBD:c.349C>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 64557 |
| 3269 | CD 147 TGA>CGA | N/A | HBD:c.442T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 64650 |
| 1346 | Poly A +69 (G>A) | N/A | HBD:c.*199G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 64851 |
| 298 | Filipino (~45 kb deletion) | N/A | NG_000007.3:g.66258_184734del118477 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66258 |
| 2283 | South-Italy | N/A | NC_000011.10:g.5164564_5230714del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66902 |
| 2157 | Indian (4056 bp deletion) | N/A | NG_000007.3:g.67357_71413del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 67357 |
| 296 | Dutch (12620 bp deletion) | N/A | NG_000007.3:g.68071_80682del12612 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 68071 |
| 289 | Croatian (1605 bp deletion) | N/A | NG_000007.3:g.69561_71164del1604 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69561 |
| 2150 | 1357 bp deletion (Taiwanese deletion) | N/A | NG_000007.3:g.69997_71353del1357 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69997 |
| 288 | Black, British (1393 bp deletion) | N/A | NG_000007.3:g.70060_71452del1393 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70060 |
| 2125 | Afghan (909 bp deletion) | N/A | HBB:c.-528_251del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70067 |
| 285 | Black (532 bp deletion) | N/A | HBB:c.-504_28del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70091 |
| 3277 | 538 bp deletion | N/A | HBB:c.-464_74del | NG_000007.3:g.70131_70668del | β | Causative | β-thalassaemia | NG_000007.3 | 70131 |
| 3278 | 1517 bp deletion | N/A | HBB:c.-390_316-169delinsA | NG_000007.3: g.70205_ 71721delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 70205 |
| 3081 | -223 T>C | N/A | HBB:c.-273T>C | β | Causative | β-thalassaemia | NG_000007.3 | 70322 |
| 3562 | -198 A>G | N/A | HBB:c.-248A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70347 |
| 1 | -190 (G>A) | N/A | HBB:c.-240G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70355 |
| 2122 | 125 bp deletion | N/A | NG_000007.3:g.70360_70485del125 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70360 |
| 2153 | Kabylia deletion/insertion | N/A | NG_000007.3:g.70417_72458delinsATAAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70417 |
| 283 | 290 bp deletion | N/A | HBB:c.-176_92+25del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70419 |
| 2 | -102 (C>A) | N/A | HBB:c.-152C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70443 |
| 3 | -101 (C>T) | N/A | HBB:c.-151C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
| 4 | -101 (C>G) | N/A | HBB:c.-151C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
| 3059 | -98 T>A | N/A | HBB:c.-148T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70447 |
| 5 | -93 C>G | N/A | HBB:c.-143C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70452 |
| 6 | -92 (C>T) | N/A | HBB:c.-142C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70453 |
| 7 | -90 (C>T) | N/A | HBB:c.-140C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
| 3224 | -90 (C>G) | N/A | HBB:c.-140C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
| 8 | -88 (C>T) | N/A | HBB:c.-138C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
| 9 | -88 (C>A) | N/A | HBB:c.-138C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
| 2178 | -88 C>G | N/A | HBB:c.-138C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
| 10 | -87 C>G | N/A | HBB:c.-137C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
| 11 | -87 (C>T) | N/A | HBB:c.-137C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
| 12 | -87 (C>A) | N/A | HBB:c.-137C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
| 13 | -86 C>G | N/A | HBB:c.-136C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
| 14 | -86 (C>A) | N/A | HBB:c.-136C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
| 3077 | -83 G>A | N/A | HBB:c.-133G>A | β | Causative | β-thalassaemia | NG_000007.3 | 70462 |
| 3069 | -77 G>C | N/A | HBB:c.-127G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70468 |
| 3386 | -76 C>A | N/A | HBB:c.-126C>A | β | Causative | β-thalassaemia | NG_000007.3 | 70469 |
| 15 | -73 (A>T) | N/A | HBB:c.-123A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70472 |
| 2997 | -72 T>A | N/A | HBB:c.-122T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70473 |
| 2171 | -71 C>T | N/A | HBB:c.-121C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70474 |
| 16 | -56 G>C | N/A | HBB:c.-106G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70489 |
| 17 | -50 G>A | N/A | HBB:c.-100G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70495 |
| 3060 | -42 C>G | N/A | HBB:c.-92C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
| 2172 | -41 A>T | N/A | HBB:c.-91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70504 |
| 18 | -32 (C>A) | N/A | HBB:c.-82C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
| 19 | -32 (C>T) | N/A | HBB:c.-82C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
| 20 | -31 (A>G) | N/A | HBB:c.-81A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
| 21 | -31 (A>C) | N/A | HBB:c.-81A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
| 22 | -30 (T>A) | N/A | HBB:c.-80T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
| 23 | -30 (T>C) | N/A | HBB:c.-80T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
| 2179 | -30 T>G | N/A | HBB:c.-80T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
| 3062 | -30 (-T) | N/A | HBB:c.-80delT | β | Causative | β-thalassaemia | NG_000007.3 | 70515 |
| 24 | -29 to -26 (-AA) | N/A | HBB:c.-79_78delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
| 25 | -29 (A>G) | N/A | HBB:c.-79A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
| 26 | -29 (A>C) | N/A | HBB:c.-79A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
| 28 | -28 (A>C) | N/A | HBB:c.-78A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
| 29 | -28 (A>G) | N/A | HBB:c.-78A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
| 30 | -27 (A>T) | N/A | HBB:c.-77A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
| 31 | -27 (-AA) | N/A | HBB:c.-77_-76delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
| 2175 | -26 A>C | N/A | HBB:c.-76A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70519 |
| 32 | -25 (G>C) | N/A | HBB:c.-75G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70520 |
| 2565 | -25 G>T | N/A | HBB:c.-75G>T | β | Causative | β-thalassaemia | NG_000007.3 | 70520 |
| 282 | 105 bp deletion | N/A | HBB:c.-74_31del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70521 |
| 34 | CAP +1 (A>C) | N/A | HBB:c.-50A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70545 |
| 3464 | CAP +3 A>T | N/A | HBB:c.-48A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70547 |
| 35 | CAP +8 (C>T) | N/A | HBB:c.-43C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70552 |
| 36 | CAP +10 (-T) | N/A | HBB:c.-41delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70554 |
| 38 | CAP +22 (G>A) | N/A | HBB:c.-29G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
| 3345 | CAP +22 (G>T) | N/A | HBB:c.-29G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
| 33 | -22 to +23 (+45 bp duplication) | N/A | NG_000007.3:g.70573_70617dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70573 |
| 2536 | CAP +30 T>A | N/A | HBB:c.-21T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70574 |
| 39 | CAP +33 (C>G) | N/A | HBB:c.-18C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70577 |
| 2176 | CAP +39 C>T | N/A | NG_000007.3:g.70583C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70583 |
| 3600 | CAP +39 (C>T) | N/A | HBB:c.-12C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70583 |
| 40 | CAP +41 to +44 (-AACA) | N/A | HBB:c.-11_-8delAAAC | β | Causative | β-thalassaemia | NG_000007.3 | 70585 |
| 41 | CAP +45 (G>C) | Hb Odisha | HBB:c.-6G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70589 |
| 42 | Init CD ATG>GTG | N/A | HBB:c.1A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
| 43 | Init CD ATG>CTG | N/A | HBB:c.1A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
| 44 | Init CD ATG>ACG | N/A | HBB:c.2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
| 45 | Init CD ATG>AGG | N/A | HBB:c.2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
| 46 | Init CD ATG>AAG | N/A | HBB:c.2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
| 47 | Init CD ATG>ATC | N/A | HBB:c.3G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
| 48 | Init CD ATG>ATA | N/A | HBB:c.3G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
| 49 | Init CD ATG>ATT | N/A | HBB:c.3G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
| 50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
| 51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.8_16delinsCTGAGGTGAAGTCTGCCTGAGGAGAAGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70602 |
| 3014 | CD 2 CAT>C-T | N/A | HBB:c.8delA | β | Causative | β-thalassaemia | NG_000007.3 | 70602 |
| 3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
| 52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
| 55 | CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG) | N/A | HBB:c.[15T>A;16C>T;19G>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70609, 70610, 70613 |
| 54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
| 2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
| 56 | CD 6 (GAG>TAG) | N/A | HBB:c.19G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
| 2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
| 57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
| 58 | CD 6 (-G) | N/A | HBB:c.20delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
| 59 | CD 6-10 (-13 bp) | N/A | HBB:c.20_32del13 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
| 60 | CD 7 GAG>TAG | N/A | HBB:c.22G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70616 |
| 3288 | CD7 GAG>G-G | N/A | HBB:c.23delA | β | Causative | β-thalassaemia | NG_000007.3 | 70617 |
| 2958 | CD 7/8 (+G) | N/A | HBB:c.24dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70618 |
| 61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
| 2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
| 62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
| 3513 | CD 8 AAG>AA- | N/A | HBB:c.27delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
| 63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
| 65 | CD 10 (GCC>GCA) | N/A | HBB:c.33C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
| 66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
| 67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
| 154 | CD 45/46(+A) | N/A | HBB:c.38_139insA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70632 |
| 3248 | CD 13 GCC>GTC [Ala>Val] | N/A | HBB:c.41C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70635 |
| 68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
| 2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
| 69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
| 70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
| 72 | CD 15 TGG>TAG | N/A | HBB:c.47G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70641 |
| 73 | CD 15 TGG>TGA | N/A | HBB:c.48G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70642 |
| 71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
| 74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
| 75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
| 76 | CD 16 GGC>GGT [Gly>Gly] | N/A | HBB:c.51C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
| 77 | CD 17 (AAG>TAG) | N/A | HBB:c.52A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70646 |
| 78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
| 80 | CD 20-22 (GTGGATGAA>GTGAA) | N/A | HBB:c.64_67del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
| 81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
| 83 | CD 22 (GAA>TAA) | N/A | HBB:c.67G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70661 |
| 84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
| 85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
| 2174 | CD 24 -G | N/A | HBB:c.74delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
| 86 | CD 24 GGT>GGA [Gly>Gly] | N/A | HBB:c.75T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70669 |
| 281 | IVS I [3 end] -44 bp (44 bp deletion) | N/A | HBB:c.76_92+27del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70670 |
| 87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
| 89 | CD 26 (GAG>TAG) | N/A | HBB:c.79G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
| 90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
| 3409 | CD 26 GAG>AAG, IVS I-7 A>G | Hb E-Udon Thani | HBB:c.[79G>A;92+7A>G] | β | Causative | β-thalassaemia | NG_000007.3 | 70673, 70693 |
| 92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
| 93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
| 95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
| 96 | CD 29 (C>T) or IVS I (-3) GGC>GGT (Gly>Gly) | N/A | HBB:c.90C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70684 |
| 97 | CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly) | N/A | HBB:c.91A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
| 98 | CD 30 (A>C) or IVS I (-2) AGG>CGG [Arg>Arg] | N/A | HBB:c.91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
| 3484 | CD 30 (-A) or IVS I (-2) AGG>-GG | N/A | HBB:c.91delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
| 99 | CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys) | N/A | HBB:c.92G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
| 101 | IVS I-1 G>A | N/A | HBB:c.92+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
| 102 | IVS I-1 (G>T) | N/A | HBB:c.92+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
| 103 | IVS I-1 (G>C) | N/A | HBB:c.92+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
| 104 | IVS I-2 (T>G) | N/A | HBB:c.92+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
| 105 | IVS I-2 (T>C) | N/A | HBB:c.92+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
| 106 | IVS I-2 (T>A) | N/A | HBB:c.92+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
| 107 | IVS I-5 (G>C) | N/A | HBB:c.92+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
| 108 | IVS I-5 (G>T) | N/A | HBB:c.92+5G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
| 109 | IVS I-5 (G>A) | N/A | HBB:c.92+5G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
| 111 | IVS I-6 (T>C) | N/A | HBB:c.92+6T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
| 3565 | IVS I-6 (T>G) | N/A | HBB:c.92+6T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
| 112 | IVS I-7 A>T | N/A | HBB:c.92+7A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
| 3276 | IVS I-7 A>G | N/A | HBB:c.92+7A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
| 2173 | IVS I-109 (-T) | N/A | HBB:c.93-22delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
| 113 | IVS I-110 G>A | N/A | HBB:c.93-21G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70796 |
| 280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | HBB:c.93-21_96del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70796 |
| 121 | IVS I [3' end] (-17 bp) (17 bp deletion) | N/A | HBB:c.93-17_93-1delTATTTTCCCACCCTTAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70800 |
| 3008 | IVS I-115 (A>T) | N/A | HBB:c.93-16A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70801 |
| 114 | IVS I-116 (T>G) | N/A | HBB:c.93-15T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70802 |
| 124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
| 115 | IVS I-128 (T>G) | N/A | HBB:c.93-3T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70814 |
| 116 | IVS I-129 (A>C) | N/A | HBB:c.93-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
| 117 | IVS I-129 (A>G) | N/A | HBB:c.93-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
| 118 | IVS I-130 G>C | N/A | HBB:c.93-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
| 119 | IVS I-130 (G>A) | N/A | HBB:c.93-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
| 120 | IVS I-130 (+1) or CD 30, (G>C); AGG>AGC (Arg>Ser) | N/A | HBB:c.93G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70817 |
| 126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
| 130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
| 132 | CD 35 TAC>TGC [Tyr>Cys] | N/A | HBB:c.107A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70831 |
| 133 | CD 35 TAC>TAA | N/A | HBB:c.108C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70832 |
| 3023 | CD 35 TAC>TAG | N/A | HBB:c.108C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
| 128 | CD 36 CCT>C-T | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
| 135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
| 134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
| 138 | CD 37 (TGG>TAG) | N/A | HBB:c.113G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70837 |
| 136 | CD 37 -G | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
| 137 | CD 37 (TGG>TGA) | N/A | HBB:c.114G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
| 139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120delGACCCAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
| 141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
| 140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
| 142 | CD 39 (CAG>TAG) | N/A | HBB:c.118C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
| 2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
| 143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
| 144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
| 145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
| 146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
| 147 | CD 41/42 (-CTTT) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
| 148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
| 149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
| 150 | CD 43 (GAG>TAG) | N/A | HBB:c.130G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
| 3594 | CD 43 (GAG>TAG);CD 71/72 (+A) | N/A | HBB:c.[130G>T;217dupA] | β | Causative | β-thalassaemia | NG_000007.3 | 70854, 70941 |
| 151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
| 152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
| 153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
| 2960 | CD 46/47 (+G) | N/A | HBB:c.142_142dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70866 |
| 155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
| 156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
| 2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
| 157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
| 3571 | CD 50 ACT>GCT [Thr>Ala] | N/A | HBB:c.151A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70875 |
| 158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
| 159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
| 2959 | CD 52 GAT>G-T | N/A | HBB:c.158delA | β | Causative | β-thalassaemia | NG_000007.3 | 70882 |
| 160 | CD 53 (-T) | N/A | HBB:c.162delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70886 |
| 161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
| 162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
| 164 | CD 54-58 (-13bp) | N/A | HBB:c.165_177delTATGGGCAACCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
| 163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
| 165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
| 2990 | CD 55-59 (-13 bp) | N/A | HBB:c.167_179del | β | Causative | β-thalassaemia | NG_000007.3 | 70891 |
| 166 | CD 56-60 +14 bp | N/A | HBB:c.170_171insGCAACCCTAAGGTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
| 167 | CD 57/58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
| 3311 | CD 58 CCT>C-T | N/A | HBB:c.176delC | β | Causative | β-thalassaemia | NG_000007.3 | 70900 |
| 169 | CD 59 (AAG>TAG) | N/A | HBB:c.178A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70902 |
| 3061 | CD 59 (+T) | N/A | HBB:c.178_179insT | β | Causative | β-thalassaemia | NG_000007.3 | 70902 |
| 168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
| 172 | CD 61 (AAG>TAG) | N/A | HBB:c.184A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70908 |
| 2431 | CD 61/62 +65 bp | N/A | HBB:c.187_251dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 70911 |
| 3589 | CD 62-65 (-12bp) | N/A | HBB:c.187_198delGCTCATGGCAAG | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 70911 |
| 171 | CD 62-64 (-7 bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
| 3100 | CD 62-64 (-7bp): (-TCATGGC) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
| 173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
| 174 | CD 66 (AAA>TAA) | N/A | HBB:c.199A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70923 |
| 2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
| 175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
| 3019 | CD 68-70 (-7bp): (-TCGGTGC) | N/A | HBB:c.206_212delTCGGTGC | β | Causative | β-thalassaemia | NG_000007.3 | 70930 |
| 2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
| 2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
| 176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
| 2462 | CD 71 -T | N/A | HBB:c.216delT | β | Causative | β-thalassaemia | NG_000007.3 | 70940 |
| 177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
| 178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
| 2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
| 3374 | CD 72 AGT>AGA [Ser>Arg]; CD 73 GAT>TAT [Asp>Tyr] | Hb South China | HBB:c.[219T>A;220G>T] | β | Causative | β-thalassaemia | NG_000007.3 | 70943, 70944 |
| 179 | CD 74/75 (-C) | N/A | HBB:c.225delC or HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70949 |
| 180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
| 181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
| 182 | CD 77/78 (-C) | N/A | HBB:c.232delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70956 |
| 3299 | CD 77/78 (+C) | N/A | HBB:c.235dupC | β | Causative | β-thalassaemia | NG_000007.3 | 70959 |
| 3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
| 183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
| 184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
| 185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
| 2190 | CD 83 (+65 bp duplication) | N/A | HBB:c.187_251dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
| 2484 | CD 83/84 +65 bp | N/A | HBB:c.252_253insNG_000007.3:g.70911_70975 | β | Causative | β-thalassaemia | NG_000007.3 | 70976 |
| 186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
| 187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
| 188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
| 3253 | CD 88 CTG>--G (HBB:c.265_266delCT) | N/A | HBB:c.265_266del | β | Causative | β-thalassaemia | NG_000007.3 | 70989 |
| 189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
| 190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
| 3287 | CD 89-93 (-14bp): (-AGTGAGCTGCACTG) | N/A | HBB:c.268_281delAGTGAGCTGCACTG | β | Causative | β-thalassaemia | NG_000007.3 | 70992 |
| 191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
| 192 | CD 90 GAG>TAG | N/A | HBB:c.271G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70995 |
| 3044 | CD 90 GAG>-AG | N/A | HBB:c.271delG | β | Causative | β-thalassaemia | NG_000007.3 | 70995 |
| 3057 | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | N/A | HBB:c.272_295dup | β | Causative | β-thalassaemia | NG_000007.3 | 70996 |
| 3133 | IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu] | N/A | HBB:c.[315+1G>A; 274C>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70998, 71040 |
| 194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
| 196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
| 2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
| 200 | IVS II-1 G>A | N/A | HBB:c.315+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
| 201 | IVS II-1 G>C | N/A | HBB:c.315+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
| 202 | IVS II-1 G>T | N/A | HBB:c.315+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
| 203 | IVS II-2 T>C | N/A | HBB:c.315+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 204 | IVS II-2 (T>A) | N/A | HBB:c.315+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 205 | IVS II-2 (-T) | N/A | HBB:c.315+2del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 2182 | IVS II-2 -TGAGTCTATGGG | N/A | HBB:c.315+2_315+13delTGAGTCTATGGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 3226 | IVS II-2 T>G | N/A | HBB:c.315+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 207 | IVS II 4/5 -AG | N/A | NG_000007.3:g.71043_71044delAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71043 |
| 208 | IVS II-5 (G>C) | N/A | HBB:c.315+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71044 |
| 286 | Asian Indian (619 bp deletion) | N/A | NG_000007.3:g.71609_72227del619 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71609 |
| 210 | IVS II-613 C>T | N/A | HBB:c.316-238C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71652 |
| 3391 | IVS-II-648/649 (-T) | N/A | HBB:c.316-202del | β | Causative | β-thalassaemia | NG_000007.3 | 71688 |
| 211 | IVS II-654 C>T | N/A | HBB:c.316-197C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71693 |
| 212 | IVS II-705 (T>G) | N/A | HBB:c.316-146T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71744 |
| 213 | IVS II-726 A>G | N/A | HBB:c.316-125A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71765 |
| 214 | IVS II-745 C>G | N/A | HBB:c.316-106C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71784 |
| 215 | IVS II-761 A>G | N/A | HBB:c.316-90A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71800 |
| 2200 | IVS II-765 L1 insertion | N/A | HBB:c.316-86_316-85insCTGCTTTTATTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71804 |
| 2183 | IVS II-781 C>G | N/A | HBB:c.316-70C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71820 |
| 216 | IVS II-815 (C>T) | N/A | HBB:c.316-36C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71854 |
| 3558 | IVS II-821 (A>C) | N/A | HBB:c.316-30A>C | β | Causative | β-thalassaemia | NG_000007.3 | 71860 |
| 217 | IVS II-837 (T>G) | N/A | HBB:c.316-14T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71876 |
| 218 | IVS II-843 (T>G) | N/A | HBB:c.316-8T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71882 |
| 219 | IVS II-844 (C>A) | N/A | HBB:c.316-7C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
| 220 | IVS II-844 (C>G) | N/A | HBB:c.316-7C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
| 221 | IVS II-848 (C>A) | N/A | HBB:c.316-3C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
| 222 | IVS II-848 (C>G) | N/A | HBB:c.316-3C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
| 3045 | IVS II-848 C>T | N/A | HBB: c.316-3C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71887 |
| 223 | IVS II-849 (A>G) | N/A | HBB:c.316-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
| 224 | IVS II-849 (A>C) | N/A | HBB:c.316-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
| 225 | IVS II-850 G>C | N/A | HBB:c.316-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 226 | IVS II-850 (G>A) | N/A | HBB:c.316-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 227 | IVS II-850 (G>T) | N/A | HBB:c.316-1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 228 | IVS II-850 (-G) | N/A | HBB:c.316-1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 231 | CD 106/107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
| 2191 | CD 107-111 (-12 bp) | N/A | HBB:c.323_334delGGCAACGTGCTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
| 3344 | CD 107 +G | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia | NG_000007.3 | 71897 |
| 3024 | CD 111-115 (-12bp): (-TCTGTGTGCTGG) | N/A | HBB:c.335-346del12bp | β | Causative | β-thalassaemia | NG_000007.3 | 71909 |
| 235 | CD 112 (TGT>TGA) | N/A | HBB:c.339T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
| 2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
| 240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
| 3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
| 2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
| 2195 | CD 125-127 (-CAGTGC) | N/A | HBB:c.377_382delCAGTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71951 |
| 3563 | CD 126 GTG>-TG | N/A | HBB:c.379delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71953 |
| 2196 | CD 130 TAT>TAA | N/A | HBB:c.393T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71967 |
| 258 | CD 131 (CAG>TAG) | N/A | HBB:c.394C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71968 |
| 2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
| 259 | CD 131/132 (+GCCT) | N/A | HBB:c.396_397insGCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
| 262 | CD 132 (AAA>TAA) | N/A | HBB:c.397A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
| 3361 | CD 138/139 (+T) | N/A | HBB:c.417dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71991 |
| 267 | Terminal CD +6 C>G [CAP +1480] | N/A | HBB:c.*6C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72024 |
| 2177 | Terminal CD +32 A>C | N/A | HBB:c.*32A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72050 |
| 268 | Terminal CD +47 C>G | N/A | HBB:c.*47C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72065 |
| 269 | 3'UTR -13 bp [CAP +1567 to +1579] | N/A | HBB:c.*93_*105delATCTGGATTCTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72111 |
| 3048 | 3' UTR, +C, -TGGATTCT | N/A | HBB:c.*96_*103delTGGATTCTinsC | β | Causative | β-thalassaemia | NG_000007.3 | 72113 |
| 3443 | Cap +1570 (T>C) | N/A | HBB:c*96T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72114 |
| 270 | Poly A (A>C) AATAAA>CATAAA | N/A | HBB:c.*108A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
| 271 | Poly A (A>G) AATAAA>GATAAA | N/A | HBB:c.*108A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
| 272 | Poly A (T>C) AATAAA>AACAAA | N/A | HBB:c.*110T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 273 | Poly A (T>A) AATAAA>AAAAAA | N/A | HBB:c.*110T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 277 | Poly(A) (-TA); (AATAAA>AAAA) | N/A | HBB:c.*110_*111delTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 278 | polyA (-AATAA) (polyA (-TAAAA)) | N/A | HBB:c.*110_*114del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 274 | Poly A (A>G) AATAAA>AATGAA | N/A | HBB:c.*111A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72129 |
| 2199 | Poly A (-AA) AATAAA>AAT--A | N/A | NG_000007.3:g.72129_72130delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72129 |
| 275 | Poly A (A>G) AATAAA>AATAGA | N/A | HBB:c.*112A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
| 2198 | Poly A (A>T) AATAAA>AATATA | N/A | HBB:c.*112A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
| 276 | Poly A (A>G) AATAAA>AATAAG | N/A | HBB:c.*113A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72131 |
| 3046 | polyA (-AA) | N/A | HBB:c.*115_*116delAA | β | Causative | β-thalassaemia | NG_000007.3 | 72133 |
| 2564 | 3'UTR +1592 (A>G) | N/A | HBB:c.*118A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72136 |
| 2463 | 3' UTR +101 G>C | N/A | HBB:c.*233G>C | β | Causative | β-thalassaemia | NG_000007.3 | 72251 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2020-07-10 12:34:14