IthaGenes

Loading... Please wait!

Quick filtering

Showing all entries assigned as Thalassaemia (Show All):

IthaID	Common Name	Hb Name	HGVS Name	Genes	Functionality	Phenotype	Locus	Position
345	Init CD ATG>GTG	N/A	HBA2:c.1A>G	α3.7 hybrid	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1
346	Init CD ACCATG>--CATG	N/A	HBA2:c.-3delAC	α3.7 hybrid	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1
410	CD 125 CTG>CAG [Leu>Gln]	Hb Weste-Einde	HBA2:c.377T>A	α3.7 hybrid	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1
2252	--BR	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1
2417	CD 31 AGG>--G	N/A	HBA1:c.94_95delAG \| HBA2:c.94_95delAG	α3.7 hybrid	Causative	α-thalassaemia	NG_000006.1
3407	(αα)JS	N/A	NC_000016.9:g.96621_176318del	HS40, NPRL3	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1
3408	--60.2	N/A	NC_000016.9:g.197577_257872del	ζ, α2, α1, HBM	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1
3588	--OY	N/A	NC_000016.10:g.0_318539del	HS40, ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1
3622	--71.8 (71.8 Kb deletion)	N/A	NC_000016.10:g.138971_210817del	ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1
3631	CD 104 TGC>TAC	Hb Sallanches	HBA2:c.314G>A	α3.7 hybrid	Causative	α-thalassaemia	NG_000006.1
3663	HS-40 deletion	N/A	NC_000016.10:g.(47217_113592)_(113687_143639)del	HS40	Causative	α-thalassaemia	NG_000006.1
301	-α4.2	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
302	-α2.4	N/A	N/A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
306	-α7.9	N/A	N/A	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
307	-α18 (18 kb deletion)	N/A	N/A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
316	-(α)5.2	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
322	--CI (28+ kb deletion.)	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
324	--115	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
326	--YEM	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
329	--KOL	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
330	--11.1 (11.1 kb deletion)	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
331	--OH	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
332	(αα)RA	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
333	(αα)TI	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
334	(αα)IJ	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
335	(αα)CMO	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
336	(αα)TAT	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
337	(αα)MB	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
338	(αα)IC	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
339	(αα)IdF	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2230	-α3.7 (type II)	N/A	N/A	α2, α1, α3.7 hybrid	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2231	-α3.7 (type III)	N/A	N/A	α2, α1, α3.7 hybrid	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2233	-ζ	N/A	N/A	ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2234	-α16.6	N/A	N/A	ζ, α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2235	α-αΔ970 (970 bp deletion)	N/A	N/A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2236	--DUTCH I	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2237	--AW	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2238	--BGS	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2239	--CAMPANIA	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2240	--FIL-2 (27.9 deletion)	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2241	--ED	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2242	--GP	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2243	(αα)AS	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2244	(αα)JM	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2245	(αα)MM	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2246	(αα)L	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2247	(αα)SN	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2248	(αα)Sco	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2249	(αα)ZW	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2250	(αα)RSR	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2251	(αα)MCu	N/A	N/A	HS40, ζ	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2253	--ZW	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2254	--JY	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2255	--LC	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2256	--VR	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2257	--JT	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2258	--AB	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2259	--GZ	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2260	Dutch II	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2261	--MK	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2262	--80	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2263	α-ZF	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2264	--Brazil	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2265	--PV	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2266	--HN	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2267	--FT	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2268	--BA	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2269	--TN	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2270	--BO	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2271	--IM	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2272	--LIN	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2273	--GS	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
2555	α12 (HBA2 gene conversion)	N/A	N/A	α2, α1	Causative	α-thalassaemia	NG_000006.1	0
2562	(αα)HS40del (hg19 chr16:g.(?_103625)_(163701_193676)del)	N/A	chr16:g.(?_103,625)_163,701_193,676)del	HS40	Causative	α-thalassaemia	NG_000006.1	0
2567	BS duplication	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	0
2568	FD duplication	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	0
2570	Sardinian duplication	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	0
3021	--JAL	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	0
3022	--LOD	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	0
3067	--MEX1	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3068	--MEX2	N/A	N/A	HS40, ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	0
3070	αααα282	N/A	N/A	HS40, ζ, α2, α1, NPRL3	Causative	β-thalassaemia	NG_000006.1	0
3071	--235	N/A	N/A	HS40, ζ, α2, α1, NPRL3	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3074	(αα)JX	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3076	αααα391	N/A	N/A	HS40, ζ, α2, α1	Causative	β-thalassaemia	NG_000006.1	0
3142	-α6.3	N/A	NG_000006.1:g.31022_37366del6344	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3214	44.6 kb deletion	N/A	NC_000016.9:g.194214_238840del	ζ, α2, α1, HBM	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3215	--Braz	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3244	−KOZANI	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3255	--MEX3	N/A	NC_000016.10:g.151479_182582del	ζ, α2, α1, HBM	Causative	α-thalassaemia	NG_000006.1	0
3258	--NFLD	N/A	NC_000016.10:g.169197_259919delinsCACCCAGCACCCAGTACCA	α2, α1	Causative	α-thalassaemia	NG_000006.1	0
3265	α-globin cluster triplication	N/A	N/A	HS40, ζ, α2, α1, HBM	Causative	β-thalassaemia	NG_000006.1	0
3273	--VS	N/A	N/A	HS40, ζ, α2, α1, HBM, AXIN1	Causative	α-thalassaemia	NG_000006.1	0
3274	--CBR	N/A	N/A	HS40, ζ, α2, α1, HBM	Causative	α-thalassaemia	NG_000006.1	0
3275	(αα)ALT	N/A	N/A	HS40	Causative	α-thalassaemia	NG_000006.1	0
3283	--JS	N/A	N/A	α2, α1	Causative	α-thalassaemia	NG_000006.1	0
3284	--PG	N/A	NG_000006.1:g.93628_542759del450131	HS40, ζ, α2, α1, NPRL3, HBM, AXIN1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3292	15 kb deletion	N/A	N/A	α2, α1, HBM	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3293	97 kb deletion	N/A	N/A	HS40	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3294	22 kb deletion	N/A	N/A	α2, α1, HBM	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3295	225 kb deletion	N/A	N/A	HS40, ζ, α2, α1, HBM	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3296	--GB	N/A	N/A	α2, α1, HBM	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3327	--GX	N/A	N/A	HS40, ζ, α2, α1, NPRL3, HBM	Causative	α-thalassaemia	NG_000006.1	0
3440	-αMAL3.5	N/A	NG_000006.1:g.32745_36301del	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
3514	170 kb deletion	N/A	N/A	α2, α1, AXIN1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	0
327	--MC	N/A	NG_000006.1:g.164_43364del43201	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	164
3607	63 Kb deletion	N/A	NC_000016.10:g.(143655_149367)_(181204_206338)del	ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	4518
3595	--CR	Hb Chiang Rai	NC_000016.10:g.144215_188843del	ζ, α2, α1, HBM	Causative	α-thalassaemia	NG_000006.1	5078
2554	-α28.5	N/A	NG_000006.1g.7065_35627del28563	ζ, α2	Causative	α-thalassaemia	NG_000006.1	7065
323	--CAL	N/A	NG_000006.1:g.8464_40664del32201	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	8464
313	--MED II	N/A	N/A	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	8726
3020	--DANE	N/A	NG_000006.1: g.8800_40007del31208	ζ, α2, α1	Causative	α-thalassaemia	NG_000006.1	8800
2232	-α27.6	N/A	NG_000006.1:g.9079_36718del27640	ζ, α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	9079
310	--THAI	N/A	NC_000016.10:g.149863_183312del	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	10726
325	--RT	N/A	NG_000006.1:g.12264_49164del36901	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	12264
311	--FIL	N/A	NC_000016.10:g.151641_182316del	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	12504
321	--CL	N/A	NG_000006.1:g.13314_124664del111351	ζ, α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	13314
2475	21.9 kb deletion with 29 bp insertion (Qinzhou type deletion)	N/A	NG_000006.1:g.[14373_36299del21927; insGGGAAGGGTGGGTGGGAATAACAGCTTTT]	ζ, α2	Causative	α-thalassaemia	NG_000006.1	14373
320	--BRIT	N/A	NG_000006.1:g.16364_45664del29301	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	16364
314	-(α)20.5	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	18200
319	--MA	N/A	NG_000006.1:g.18964_39864del20901	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	18964
315	--SA	N/A	NG_000006.1:g.19464_43064del23601	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	19464
312	--MED I	N/A	N/A	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	23662
309	--SEA	N/A	NG_000006.1:g.26264_45564del19301	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	26264
305	-α5.3	N/A	NG_000006.1:g.28684_33930del5246	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	28684
328	--CANT	N/A	NC_000016.10:g.(168531_169756)_(182770_183028)del	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	29394
3603	-α6.9	N/A	NG_000006.1:g.29785_36746del	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	29785
318	--SPAN	N/A	NC_000016.10:g.(169756_170100)_(179044_181595)del	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	30619
3018	--NOR	N/A	NC_000016.10:g.170678_184085del	α2, α1	Causative	α-thalassaemia	NG_000006.1	31541
3360	9.7 kb deletion	N/A	NG_000006.1:g.32709_42418del	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	32709
317	--GEO	N/A	NG_000006.1:g.32864_42264del9401	α2, α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	32864
3268	811 bp deletion	N/A	NG_000006.1:g.32945_33755	α2	Causative	α-thalassaemia	NG_000006.1	32945
2988	-54 G>A	N/A	HBA2:c.-91G>A	α2	Causative	α-thalassaemia	NG_000006.1	33685
2967	-22 C>T	N/A	HBA2:c.-59C>T	α2	Causative	α-thalassaemia	NG_000006.1	33717
3051	Init CD ACCATG>-CCATG	N/A	HBA2:c.-3delA	α2	Causative	α-thalassaemia	NG_000006.1	33773
344	Init CD ATG>-TG	N/A	HBA2:c.1delA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33776
3050	Init CD ATG>TTG [Met>Leu]	N/A	HBA2:c.1A>T	α2	Causative	α-thalassaemia	NG_000006.1	33776
3604	Init CD ATG>GTG [Met>Pro]	N/A	HBA2:c.1A>G	α2	Causative	α-thalassaemia	NG_000006.1	33776
342	Init CD ATG>ACG [Met>Thr]	N/A	HBA2:c.2T>C	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33777
343	Init CD ATG>A-G	N/A	HBA2:c.2delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33777
2460	Init CD ATG>AGG [Met>Arg]	N/A	HBA2:c.2T>G	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33777
3564	Init CD ATG>ATC [Met>Ile]	N/A	HBA2:c.3G>C	α2	Causative	α-thalassaemia	NG_000006.1	33778
2469	CD 7 AAG>TAG	N/A	HBA2:c.22A>T	α2	Causative	α-thalassaemia	NG_000006.1	33797
3599	CD 13 GCC>TCC [Ala>Ser]	N/A	HBA2:c.40G>T	α2	Causative	α-thalassaemia	NG_000006.1	33815
2518	CD 14 TGG>TGA	N/A	HBA2:c.45G>A	α2	Causative	α-thalassaemia	NG_000006.1	33820
350	CD 18 GGC>G-C	N/A	HBA2:c.56delG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33831
2465	CD 19 GCG>GC-	N/A	HBA2:c.60delG	α2	Causative	α-thalassaemia	NG_000006.1	33835
2207	CD 21/22 +T	N/A	HBA2:c.66dupT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33841
352	CD 22 GGC>GGT new donor consensus	N/A	HBA2:c.69C>T	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33844
353	CD 22 -C	N/A	HBA2:c.69delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33844
354	CD 23 GAG>TAG	N/A	HBA2:c.70G>T	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33845
2208	CD 24 TAT>TAG	N/A	HBA2:c.75T>G	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33850
2488	CD 24 TAT>TAA	N/A	HBA2:c.75T>A	α2	Causative	α-thalassaemia	NG_000006.1	33850
3657	CD 26 GCG>ACG [Ala>Thr];CD 130 GCT>CCT [Ala>Pro]	Hb Southern Italy	HBA2:c.[79G>A;391G>C]	α2	Causative	α-thalassaemia	NG_000006.1	33854, 34425
3568	CD 28 GCC>-CC	N/A	HBA2:c.85delG	α2	Causative	α-thalassaemia	NG_000006.1	33860
357	CD 30 -GAG [-Glu]	N/A	HBA2:c.91_93delGAG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33866
2210	CD 31 AGG>CGG [Arg>Arg]	N/A	HBA2:c.94A>C	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33869
366	CD 31 AGG>AAG [Arg>Lys]	N/A	HBA2:c.95G>A	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33870
2483	IVS I-1 G>T	N/A	HBA2:c.95+1G>T	α2	Causative	α-thalassaemia	NG_000006.1	33871
359	IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor (α-5nt)	N/A	HBA2:c.95+2_95+6delTGAGG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33872
360	IVS I-5 G>A	N/A	HBA2:c.95+5 G>A	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33875
362	IVS I-55 G>A	N/A	HBA2:c.95+55 G>A	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33925
363	IVS I-116 GCAGGA>GCGGGA acceptor	N/A	HBA2:c.96-2A>G	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33986
2957	IVS I-117 G>A	N/A	HBA2:c.96-1G>A	α2	Causative	α-thalassaemia	NG_000006.1	33987
2211	CD 37 -C	N/A	HBA2:c.112delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34004
3052	CD 37 CCC>CC-	N/A	HBA2:c.114delC	α2	Causative	α-thalassaemia	NG_000006.1	34006
372	CD 39-41 (-9 bp, + 8 bp)	N/A	NG_000006.1:g.34010_34018delinsTACTTCCC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34010
2493	CD 40 AAG>AA-	N/A	HBA2:c.123delG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34015
2213	CD 43 TTC>-TC	N/A	HBA2:c.130delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34022
2214	CD 43 TTC>T-C	N/A	HBA2:c.131delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34023
2215	CD 43/44 -C	N/A	HBA2:c.132delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34024
3405	CD 47-53 (-24bp): (-GACCTGAGCCACGGCTCTGC)	N/A	HBA2:c.142_161delGACCTGAGCCACGGCTCTGC	α2	Causative	α-thalassaemia	NG_000006.1	34034
2216	CD 47 -A	N/A	HBA2:c.143delA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34035
3053	CD 47/48 (-4bp): (-ACCT)	N/A	HBA2:c.143_146delACCT	α2	Causative	α-thalassaemia	NG_000006.1	34035
374	CD 49 -GC	N/A	HBA2:c.149_150delGC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34041
2217	CD 51/52 +G	N/A	HBA2:c.156_157insG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34048
376	CD 54 (CAG>TAG)	N/A	HBA2:c.163C>T	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34055
3693	CD 54 CAG>-AG	N/A	HBA2:c.163delC	α2	Causative	α-thalassaemia	NG_000006.1	34055
3079	CD 55 +T	N/A	HBA2:c.168dup	α2	Causative	α-thalassaemia	NG_000006.1	34060
3054	CD 56 AAG>--G	N/A	HBA2:c.169_170delAA	α2	Causative	α-thalassaemia	NG_000006.1	34061
3286	CD 61 AAG>TAG [Lys>STOP]	N/A	HBA2:c.184A>T	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34076
2218	CD 63-76 (-42 bp)	N/A	HBA2:c.190_231del	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34082
2576	CD 68 AAC>A-C	N/A	HBA2:c.206delA	α2	Causative	α-thalassaemia	NG_000006.1	34098
3705	CD 72 (+C)	N/A	HBA2:c.217dup	α2	Causative	α-thalassaemia	NG_000006.1	34109
3055	CD 73/74 (-4bp): (-GTGG)	N/A	HBA2:c.220_223delGTGG	α2	Causative	α-thalassaemia	NG_000006.1	34112
3632	CD 76/77 (+T)	N/A	HBB:c.231_232insT	α2	Causative	α-thalassaemia	NG_000006.1	34123
3569	CD 89-93 (-13bp): (-CACAAGCTTCGGG)	N/A	HBA2:c.268_280delCACAAGCTTCGGG	α2	Causative	α-thalassaemia	NG_000006.1	34160
388	CD 90 AAG>TAG	N/A	HBA2:c.271A>T	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34163
300	-α3.7 (type I) (-α3.7)	N/A	NG_000006.1:g.34164_37967del3804	α2, α1, α3.7 hybrid	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34164
3572	CD 90‐93 (-8bp): (‐AGCTTCGG)	N/A	HBA2:c.272_279delAGCTTCGG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34164
3080	CD 94 (+21 bp duplication)	Hb SKMC	HBA2:c.283_300+3dup	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34175
3610	CD 99 AAG>TAG [Lys>STOP]	N/A	HBA2:c.298A>T	α2	Causative	α-thalassaemia	NG_000006.1	34190
391	IVS II-2 GT>GA donor	N/A	HBA2:c.300+2T>A	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34194
2430	203 bp deletion	N/A	NG_000006.1:g.34305_34507del203	α2	Causative	α-thalassaemia	NG_000006.1	34305
392	IVS II-142 G>A	N/A	HBA2:c.301-1G>A	α2	Causative	α-thalassaemia	NG_000006.1	34334
3611	CD 108 ACC>GCC [Thr>Ala]	N/A	HBA2:c.325A>G	α2	Causative	α-thalassaemia	NG_000006.1	34359
398	CD 109 (-C)	N/A	HBA1:c.328delC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34362
402	CD 112/113 -C	N/A	HBA2:c.339delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34373
403	CD 113/114 -C	N/A	HBA2:c.342delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34376
3078	CD 113 +CC	N/A	HBA2:c.342_345insCC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34376
3140	CD 114 CCC>CC-	N/A	HBA2:c.345delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34379
405	CD 116 GAG>TAG	N/A	HBA2:c.349G>T	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34383
2221	CD 115 -GAGTTCACCCC [166 aa]	N/A	HBA2:c.349_359delGAGTTCACCCC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34383
3305	CD 126 GCG>-CG	N/A	HBA2:c.379delG	α2	Causative	α-thalassaemia	NG_000006.1	34413
2519	CD 127 AAG>TAG [Lys>STOP]	N/A	HBA2:c.382A>T	α2	Causative	α-thalassaemia	NG_000006.1	34416
3612	CD 127 AAG>ATG [Lys>Met]	N/A	HBA2:c.383A>T	α2	Causative	α-thalassaemia	NG_000006.1	34417
3613	CD 129 CTG>CGG [Leu>Arg]	N/A	HBA2:c.389T>G	α2	Causative	α-thalassaemia	NG_000006.1	34423
2226	3' UTR +46 C>A	N/A	HBA2:c.*46C>A	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34509
428	3' UTR -16 bp (giving rise to CATAAA)	N/A	HBA2:c.74_89delCCTTCCTGGTCTTTGA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34537
425	Poly A (AATAAA>AATGAA) (αPolyA2)	N/A	HBA2:c.*92A>G	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34555
426	Poly A (AATAAA>AATA--)	N/A	HBA2:c.93_94delAA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34556
424	Poly A (AATAAA>AATAAG) (αPolyA1, αT-Saudi)	N/A	HBA2:c.*94A>G	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34557
427	Poly A (AATAAA>AATAAC)	N/A	HBA2:c.*94A>C	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34557
303	-α2.7	N/A	NG_000006.1:g.36664_39364del2701	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	36664
304	-α3.5	N/A	NG_000006.1:g.37464_40964del3501	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37464
3614	CAP +14 C>G	N/A	HBA1:c.-24C>G	α1	Causative	α-thalassaemia	NG_000006.1	37556
340	CAP +22 T>C	N/A	HBA1:c.-16T>C	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37564
2203	CAP +29 (G>C)	N/A	HBA1:c.-9G>C	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37571
341	Init CD ATG>GTG	N/A	HBA1:c.1A>G	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37580
3147	Init CD ATG>AAG [Met>Lys]	N/A	HBA1:c.2T>A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37581
3250	Init CD ATG>A-G	N/A	HBA1:c.2delT	α1	Causative	α-thalassaemia	NG_000006.1	37581
349	CD 14 TGG>TAG [Trp>STOP]	N/A	HBA1:c.44G>A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37623
3615	CD 14 TGG>TAG	N/A	HBA1:c.44G>A	α1	Causative	α-thalassaemia	NG_000006.1	37623
3395	CD 16 AAG>TAG [Lys>STOP]	N/A	HBA1:c.49A>T	α1	Causative	α-thalassaemia	NG_000006.1	37628
3266	CD 22 GGC>GGT [Gly>Gly]	N/A	HBA1:c.69C>T	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37648
3267	CD 23 GAG>TAG	N/A	HBA1:c.70G>T	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37649
3032	CD 28 GCC>TCC [Ala>Ser]	N/A	HBA1:c.85G>T	α1	Causative	α-thalassaemia	NG_000006.1	37664
3030	CD 30 GAG>TAG	N/A	HBA1:c.91G>T	α1	Causative	α-thalassaemia	NG_000006.1	37670
365	CD 31 AGG>--G	N/A	HBA1:c.92_93delAG	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37673
358	IVS I-1 AGGT>AGAT donor	N/A	HBA1:c.95+1G>A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37675
3049	IVS I-1 AGGT>AGCT donor	N/A	HBA1:c.95+1G>C	α1	Causative	α-thalassaemia	NG_000006.1	37675
2204	IVS I-4 A>G	N/A	HBA1:c.95+4A>G	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37678
361	IVS I-5 G>A	N/A	HBA1:c.95+5 G>A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37679
3431	IVS I-38 C>T	N/A	HBA1:c.95+38C>T	α1	Causative	α-thalassaemia	NG_000006.1	37712
2212	IVS I-45 G>C	N/A	HBA1:c.95+45G>C	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37719
2451	IVS I-116 A>G	N/A	HBA1:c.96-2A>G	α1	Causative	α-thalassaemia	NG_000006.1	37790
364	IVS I-117 GCAGGA>GCAAGA acceptor	N/A	HBA1:c.96-1G>A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37791
3251	IVS I-117 GCAGGA>GCACGA acceptor	N/A	HBA1:c.96-1G>C	α1	Causative	α-thalassaemia	NG_000006.1	37791
3403	CD 39 +A	N/A	HBA2:c.118_119insA	α2	Causative	α-thalassaemia	NG_000006.1	37814
2468	CD 44 +C	N/A	HBA1:c.134_135insC	α1	Causative	α-thalassaemia	NG_000006.1	37830
375	CD 51-55 (-13 bp deletion)	N/A	HBA1:c.155_167delGCTCTGCCCAGGT	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37851
3334	CD 61 AAG>TAG [Lys>STOP]	N/A	HBA1:c.184A>T	α1	Causative	α-thalassaemia	NG_000006.1	37880
2429	CD 62 GTG>GCG [Val>Ala]	N/A	HBA1:c.188T>C	α1	Causative	α-thalassaemia	NG_000006.1	37884
2347	CD 62 -G	N/A	HBA1:c.189delG	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37885
3373	CD 67 ACC>-CC	N/A	HBA1:c.202delA	α1	Causative	α-thalassaemia	NG_000006.1	37898
385	CD 74/75 -GAC [- Asp]	N/A	HBA1:c.212_214delGAC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37908
3326	CD 73 GTG>G-G	N/A	HBA1:c.221delT	α1	Causative	α-thalassaemia	NG_000006.1	37917
386	CD 78 -C	N/A	HBA1:c.237delC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37933
2219	CD 81 -T	N/A	HBA2:c.244delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37940
387	CD 82/83/84 del 5bp ins	N/A	HBA1:c.247_255delGCCCTGAGC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37943
390	CD 93-99 (+21 bp)	N/A	HBA1:c.280_300ins21	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37976
2467	CD 99 AAG>TAG	N/A	HBA1:c.298A>T	α1	Causative	α-thalassaemia	NG_000006.1	37994
3031	IVS II-1 G>A	N/A	HBA1:c.300+1G>A	α1	Causative	α-thalassaemia	NG_000006.1	37997
2222	IVS II-147 C>G	N/A	HBA1:c.301-3C>G	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	38142
393	IVS II-148 A>G consensus	N/A	HBA1:c.301-2A>G	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	38143
2224	CD 110-114 (-13 bp)	N/A	HBA1:c.333_345delCGCCCACCTCCCC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	38178
2225	Poly A (G>A) AATAAAG>AATAAAA	N/A	HBA1:c.*96G>A	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	38370
284	468 bp deletion	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3
2159	(εγδβ)0 with α triplication	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3
3393	3.5 kb deletion (Thai, 3485 bp deletion)	N/A	NC_000011.10:g.5224302-5227791del3490bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3
3570	1.78Mb εγδβ(0) del (Bedouin)	N/A	NC_000011.10:g.(4302665_4322227)_(6099443_6100105)del	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia, Haemolytic anaemia	NG_000007.3
3578	2.2 Mb deletion	N/A	NC_000011.10:g.4052720_6253287del	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia, Haemolytic anaemia	NG_000007.3
3606	177 Kb deletion	N/A	NC_000011.10:g.5241050_5418009del	βLCR, ε, Aγ, Gγ, pseudo β, OR51B5, OR51B6, OR51M1, OR51B2	Causative	N/A	NG_000007.3
290	Thai (3485 bp deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
291	Czech (4237 bp deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
292	Turk (~7.6 kb deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
293	Cape Verdean	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
294	Asian Indian (10329 bp deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
295	Australian (Anglo Saxon) (12023 bp deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
299	Italian (~67 kb deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
1400		Hb Lepore-Leiden	N/A	δ, β	Causative	δβ-thalassaemia	NG_000007.3	0
1511	East European (δβ)0	N/A	N/A	δ, β	Causative	δβ-thalassaemia	NG_000007.3	0
1512	Laotian (δβ)0	N/A	N/A	δ, β	Causative	δβ-thalassaemia	NG_000007.3	0
1514	Macedonian/Turkish (δβ)0 (Turkish type 2 (δβ)0 \| Turkish Inv/Del (δβ)0)	N/A	N/A	δ, β	Causative	δβ-thalassaemia	NG_000007.3	0
1515	Turkish (δβ)0 (Turkish type 3 (δβ)0)	N/A	N/A	δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1516	Leiden 7.4 kb (δβ)0	N/A	N/A	δ, β	Causative	δβ-thalassaemia	NG_000007.3	0
1517	Thai 11.3 (δβ)0	N/A	N/A	δ, β	Causative	δβ-thalassaemia, Hb F levels	NG_000007.3	0
1518	Japanese 2 (δβ)0	N/A	N/A	δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1519	Indian (Aγδβ)0 (inv) (Asian-Indian Inv/Del Gγ(Aγδβ)0)	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1521	Cantonese (Aγδβ)0	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1522	Malaysian-1 (Aγδβ)0	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1525	Belgian (Aγδβ)0	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1528	Yunnanese (Aγδβ)0	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1530	Italian (Aγδβ)0	N/A	NC_000011.9:g.(5215685_5215688)_(5270743_5270746)del55059	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1531	Canadian (Aγδβ)0	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1532	Leiden 69.5	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1533	49.3 kb Gγ(Aγδβ)0 Asian del	N/A	N/A	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	0
1534	Anglo-Saxon (εγδβ)0	N/A	NC_000011.8:g.5204501_5300223del	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1535	Irish (εγδβ)0	N/A	NC_000011.8:g.5110112_5312961del	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1536	Canadian (εγδβ)0	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1537	Scottish - Irish	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1538	English I (εγδβ)0	N/A	N/A	βLCR, ε, Gγ	Causative	εγδβ-thalassaemia	NG_000007.3	0
1539	Mexican (εγδβ)0	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1540	Hispanic (εγδβ)0	N/A	NC_000011.8:g.5257379_5297161del	βLCR	Causative	εγδβ-thalassaemia	NG_000007.3	0
1541	Croatian (εγδβ)0	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1542	Dutch I (εγδβ)0	N/A	NC_000011.8:g.5207238_5307069del99611	βLCR, ε, Aγ, Gγ, δ, pseudo β	Causative	εγδβ-thalassaemia, Haemolytic anaemia	NG_000007.3	0
1543	English II	N/A	N/A	βLCR, ε	Causative	εγδβ-thalassaemia	NG_000007.3	0
1544	English III	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1545	English IV	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1546	Chilean	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1547	Dutch II	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B5, OR51M1	Causative	εγδβ-thalassaemia	NG_000007.3	0
1548	Dutch III	N/A	N/A	βLCR, ε, Aγ, Gγ	Causative	εγδβ-thalassaemia	NG_000007.3	0
1549	Dutch IV	N/A	N/A	βLCR, ε, Aγ, Gγ, OR51B5, OR51B6	Causative	εγδβ-thalassaemia	NG_000007.3	0
1550	Dutch V	N/A	N/A	βLCR	Causative	εγδβ-thalassaemia	NG_000007.3	0
1551	Dutch VI	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1552	Japanese	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
1553	French	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
2123	7719 bp deletion	N/A	NG_000007.3:g.71550_79270del7719	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
2126	South East Asian (SEA) deletion (27 kb deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
2158	Pakistani I	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
2161	French (εγδβ)0 insertion/deletion	N/A	N/A	βLCR	Causative	εγδβ-thalassaemia	NG_000007.3	0
2163	Norwegian (εγδβ)0	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
2164	Tennessean (εγδβ)0	N/A	N/A	βLCR	Causative	εγδβ-thalassaemia	NG_000007.3	0
2165	Puerto Rican (εγδβ)0	N/A	N/A	βLCR	Causative	εγδβ-thalassaemia	NG_000007.3	0
2167	Asian Indian (εγδβ)0	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
2418	Swiss (εγδβ)0	N/A	NC_000011.9:g.(4023964_4024014)_(6928943_6928993)del2904980	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia, Haemolytic anaemia	NG_000007.3	0
2419	Senegalese δ(0)β(+)	N/A	NG_000007.3:g.(63154_63209)_(70570_70625)del7417	δ, β	Causative	δβ-thalassaemia, Haemolytic anaemia	NG_000007.3	0
2548	Inv-Del English V	N/A	NC_000011.10:g.5215690_5274684invdel5215690_5215772del5274684_5397195	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
2551	Austrian I	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
3073	Italian (εγδβ)0 deletion	N/A	NC_000011.10:g.[5194397_5357192del;5194356_5194401insAGCTAAAGGTTTTGTAAATGCACCAATCAGCAATCTGTGTCTAACTC]	ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia	NG_000007.3	0
3270	Chinese I (εγδβ)0	N/A	NC_000011.9:g.5057966_5291566del	ε, Aγ, Gγ, δ, β, pseudo β, OR51V1	Causative	εγδβ-thalassaemia	NG_000007.3	0
3340	Brazilian (εγδβ)0	N/A	N/A	βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B2	Causative	εγδβ-thalassaemia	NG_000007.3	0
3394	223 kb deletion	N/A	NC_000011.9:g.5031238_5254163del	δ, β	Causative	β-thalassaemia	NG_000007.3	0
3577	59 Kb deletion	N/A	NC_000011.10:g.5236469_5295261del	βLCR, ε, Aγ, Gγ	Causative	εγδβ-thalassaemia, Haemolytic anaemia	NG_000007.3	2355
2566	Caribbean	N/A	NG_000007.3:g.8510_13369del	βLCR	Causative	β-thalassaemia	NG_000007.3	8510
1524	Turkish (Aγδβ)0	N/A	NG_000007.3:g.45410_81665del36256	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	45410
1504	SE Asian, Thai (Aγδβ)0 (HPFH-6)	N/A	NC_000011.10:g.5172745_5252029	Aγ, δ, β, pseudo β, OR51V1, OR52Z1-OR51V1	Causative	δβ-thalassaemia, Hb F levels	NG_000007.3	45587
1520	German (Aγδβ)0	N/A	NG_000007.3:g.(45922_46319)_(98640_99640)del	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	45922
1523	Malaysian-2 (Aγδβ)0	N/A	NG_000007.3:g.(47376_47553)_(89149_90149)del	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	47376
1527	Chinese (Aγδβ)0	N/A	NG_000007.3:g.48795_127698del78904	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	48795
1526	Black (Aγδβ)0	N/A	NG_000007.3:g.49040_84889del35850	Aγ, δ, β, pseudo β	Causative	δβ-thalassaemia, Haemolytic anaemia	NG_000007.3	49040
1506	Indian (δβ)0 (32.6 kb GγΑγ(δβ)0 Indian del)	N/A	NG_000007.3:g.50509_83170del32662	δ, β, pseudo β	Causative	δβ-thalassaemia, Haemolytic anaemia	NG_000007.3	50509
1508	Japanese (δβ)0	N/A	NG_000007.3:g.51483_165148del113666	δ, β, pseudo β	Causative	δβ-thalassaemia	NG_000007.3	51483
110	IVS I-5 (G>A) + Corfu deletion (7.2 kb Corfu δβ thalassaemia, Corfu (δβ)0)	N/A	NG_000007.3:g.57237_64443del7207; HBB:c.92+5G>A	δ, β	Causative	δβ-thalassaemia	NG_000007.3	57237, 70691
1497	Corfu (δ)0 (7.2kb Corfu deletion)	N/A	NG_000007.3:g.57237_64443del7207	δ	Causative	δ-thalassaemia	NG_000007.3	57237
1509	Spanish (δβ)0	N/A	NG_000007.3:g.60375_153285del92911	δ, β	Causative	δβ-thalassaemia	NG_000007.3	60375
1510	Black (δβ)0	N/A	NG_000007.3:g.(60530_60730)_(72351_72551)del11822	δ, β	Causative	δβ-thalassaemia	NG_000007.3	60530
3601	-130 A>G	N/A	HBD:c.-180A>G	δ	Causative	δ-thalassaemia	NG_000007.3	63003
3223	CAP +48 (A>T)	N/A	HBD:c.-6A>T	δ	Causative	δ-thalassaemia	NG_000007.3	63019
2202	CAP +53 (G>A)	N/A	HBD:c.-1G>A	δ	Causative	δ-thalassaemia	NG_000007.3	63024
1321	-80 (G>A)	N/A	HBD:c.-130G>A	δ	Causative	δ-thalassaemia	NG_000007.3	63053
1322	-77 (T>C)	N/A	HBD:c.-127T>C	δ	Causative	δ-thalassaemia	NG_000007.3	63056
1323	-76 (A>T)	N/A	HBD:c.-126A>T	δ	Causative	δ-thalassaemia	NG_000007.3	63057
1324	-68 (C>T)	N/A	HBD:c.-118C>T	δ	Causative	δ-thalassaemia	NG_000007.3	63065
1325	-65 (A>G)	N/A	HBD:c.-115A>G	δ	Causative	δ-thalassaemia	NG_000007.3	63068
1326	-55 (T>C)	N/A	HBD:c.-105T>C	δ	Causative	δ-thalassaemia	NG_000007.3	63078
3602	-44 G>A	N/A	HBD:c.-94G>A	δ	Causative	δ-thalassaemia	NG_000007.3	63089
1327	-36 (C>A)	N/A	HBD:c.-86C>A	δ	Causative	δ-thalassaemia	NG_000007.3	63097
1328	-31 (A>G)	N/A	HBD:c.-81A>G	δ	Causative	δ-thalassaemia	NG_000007.3	63102
1329	-30 T>C	N/A	HBD:c.-80T>C	δ	Causative	δ-thalassaemia	NG_000007.3	63103
1330	Init CD ATG>ATA [Met>Ile]	N/A	HBD:c.3G>A	δ	Causative	δ-thalassaemia	NG_000007.3	63185
3307	N/A	Hb Lepore Rochester-MN	NG_000007.3:g.[63191_70603dup;63291_70703del]	δ, β	Causative	δβ-thalassaemia	NG_000007.3	63191
3617	CD 5 CCT>ACT [Pro>Thr]	HbA2-Partinico	HBD:c.16C>A	δ	Causative	δ-thalassaemia	NG_000007.3	63198
3231	CD 7 (-3bp): (-GAG)	N/A	HBD:c.22_24delGAG	δ	Causative	δ-thalassaemia	NG_000007.3	63204
3336	CD 7 GAG>TAG [Glu>STOP]	N/A	HBD:c.22G>T	δ	Causative	δ-thalassaemia	NG_000007.3	63204
3232	CD 10 GCT>-CT	N/A	HBD:c.31delG	δ	Causative	δ-thalassaemia	NG_000007.3	63213
1333	CD 30 (AGG>ACG)	N/A	HBD:c.92G>C	δ	Causative	δ-thalassaemia	NG_000007.3	63274
1334	IVS I-2 (T>C)	N/A	HBD:c.92+2T>C	δ	Causative	δ-thalassaemia	NG_000007.3	63276
2090	IVS I-5 G>T	N/A	HBD:c.92+5G>T	δ	Causative	δ-thalassaemia	NG_000007.3	63279
1397		Hb Lepore-Hollandia	NG_000007.3:g.63290_70702del	δ, β	Causative	δβ-thalassaemia	NG_000007.3	63290
2563	IVS I-1 (27 bp insertion)	N/A	HBD:c.92+83_84ins27	δ	Causative	δ-thalassaemia	NG_000007.3	63357
3233	IVS I 3' AG>-C	N/A	HBD:c.93-2delA	δ	Causative	δ-thalassaemia	NG_000007.3	63401
1335	IVS I 3' AG>AC	N/A	HBD:c.93-1G>C	δ	Causative	δ-thalassaemia	NG_000007.3	63402
1336	CD 37 (TGG>TAG)	N/A	HBD:c.113G>A	δ	Causative	δ-thalassaemia	NG_000007.3	63423
2575	CD 58 +C	N/A	HBD:c.176_177insC	δ	Causative	δ-thalassaemia	NG_000007.3	63486
3441	CD 59 AAG>A-G (δ0 59 (-A))	N/A	HBD:c.179delA	δ	Causative	δ-thalassaemia	NG_000007.3	63489
3237	CD59/60 (+GG)	N/A	HBD:c.180_181dupGG	δ	Causative	δ-thalassaemia	NG_000007.3	63490
2092	CD 82 AAG>TAG	N/A	NG_000007.3:g.63557A>T	δ	Causative	δ-thalassaemia	NG_000007.3	63557
1398		Hb Lepore-Baltimore	NG_000007.3:g.63564_70978del	δ, β	Causative	δβ-thalassaemia	NG_000007.3	63564
3236	CD 87 CAG>C-G	N/A	HBD:c.263delA	δ	Causative	δ-thalassaemia	NG_000007.3	63573
3598	CD 93/94 (-TG) [Cys>STOP]	N/A	HBD:c.282_283delTG	δ	Causative	N/A	NG_000007.3	63592
1338	CD 91 (+T)	N/A	HBD:c.286_287insT	δ	Causative	δ-thalassaemia	NG_000007.3	63596
1340	IVS II-1 G>A	N/A	HBD:c.315+1G>A	δ	Causative	δ-thalassaemia	NG_000007.3	63626
1341	IVS II-6 (T>A)	N/A	HBD:c.315+6T>A	δ	Causative	δ-thalassaemia	NG_000007.3	63631
1507	Sicilian (δβ)0	N/A	NG_000007.3:g.64336_77738del13403	δ, β	Causative	δβ-thalassaemia, Haemolytic anaemia	NG_000007.3	64336
1513	Thai/Vietnamese (δβ)0 (Thai (δβ)0 , Vietnamese (δβ)0 )	N/A	NG_000007.3:g.64384_76993del	δ, β	Causative	δβ-thalassaemia, Haemolytic anaemia	NG_000007.3	64384
1342	IVS II-894 C>T	N/A	HBD:c.316-5C>T	δ	Causative	δ-thalassaemia	NG_000007.3	64519
1343	IVS II-897 A>C	N/A	HBD:c.316-2A>C	δ	Causative	δ-thalassaemia	NG_000007.3	64522
2473	IVS II-897 A>G	N/A	HBD:c.316-2A>G	δ	Causative	δ-thalassaemia	NG_000007.3	64522
3234	CD 113 (+TG)	N/A	HBD:c.341_342dupTG	δ	Causative	δ-thalassaemia	NG_000007.3	64549
3230	CD 115 GCC>GTC [Ala>Val]	N/A	HBD:c.347C>T	δ	Causative	δ-thalassaemia	NG_000007.3	64555
3229	CD 116 CGC>GGC [Arg>Gly]	N/A	HBD:c.349C>G	δ	Causative	δ-thalassaemia	NG_000007.3	64557
3269	CD 147 TGA>CGA	N/A	HBD:c.442T>C	δ	Causative	δ-thalassaemia	NG_000007.3	64650
1346	Poly A +69 (G>A)	N/A	HBD:c.*199G>A	δ	Causative	δ-thalassaemia	NG_000007.3	64851
298	Filipino (~45 kb deletion)	N/A	NG_000007.3:g.66258_184734del118477	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66258
2283	South-Italy	N/A	NC_000011.10:g.5164564_5230714del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66902
2157	Indian (4056 bp deletion)	N/A	NG_000007.3:g.67357_71413del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	67357
296	Dutch (12620 bp deletion)	N/A	NG_000007.3:g.68071_80682del12612	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	68071
289	Croatian (1605 bp deletion)	N/A	NG_000007.3:g.69561_71164del1604	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	69561
2150	1357 bp deletion (Taiwanese deletion)	N/A	NG_000007.3:g.69997_71353del1357	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	69997
288	Black, British (1393 bp deletion)	N/A	NG_000007.3:g.70060_71452del1393	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70060
2125	Afghan (909 bp deletion)	N/A	HBB:c.-528_251del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70067
285	Black (532 bp deletion)	N/A	HBB:c.-504_28del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70091
3277	538 bp deletion	N/A	HBB:c.-464_74del \| NG_000007.3:g.70131_70668del	β	Causative	β-thalassaemia	NG_000007.3	70131
3278	1517 bp deletion	N/A	HBB:c.-390_316-169delinsA \| NG_000007.3: g.70205_ 71721delinsA	β	Causative	β-thalassaemia	NG_000007.3	70205
3081	-223 T>C	N/A	HBB:c.-273T>C	β	Causative	β-thalassaemia	NG_000007.3	70322
3562	-198 A>G	N/A	HBB:c.-248A>G	β	Causative	β-thalassaemia	NG_000007.3	70347
1	-190 (G>A)	N/A	HBB:c.-240G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70355
2122	125 bp deletion	N/A	NG_000007.3:g.70360_70485del125	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70360
2153	Kabylia deletion/insertion	N/A	NG_000007.3:g.70417_72458delinsATAAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70417
283	290 bp deletion	N/A	HBB:c.-176_92+25del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70419
2	-102 (C>A)	N/A	HBB:c.-152C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70443
3	-101 (C>T)	N/A	HBB:c.-151C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70444
4	-101 (C>G)	N/A	HBB:c.-151C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70444
3059	-98 T>A	N/A	HBB:c.-148T>A	β	Causative	β-thalassaemia	NG_000007.3	70447
5	-93 C>G	N/A	HBB:c.-143C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70452
6	-92 (C>T)	N/A	HBB:c.-142C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70453
7	-90 (C>T)	N/A	HBB:c.-140C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70455
3224	-90 (C>G)	N/A	HBB:c.-140C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70455
8	-88 (C>T)	N/A	HBB:c.-138C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70457
9	-88 (C>A)	N/A	HBB:c.-138C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70457
2178	-88 C>G	N/A	HBB:c.-138C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70457
10	-87 C>G	N/A	HBB:c.-137C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70458
11	-87 (C>T)	N/A	HBB:c.-137C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70458
12	-87 (C>A)	N/A	HBB:c.-137C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70458
13	-86 C>G	N/A	HBB:c.-136C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70459
14	-86 (C>A)	N/A	HBB:c.-136C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70459
3077	-83 G>A	N/A	HBB:c.-133G>A	β	Causative	β-thalassaemia	NG_000007.3	70462
3069	-77 G>C	N/A	HBB:c.-127G>C	β	Causative	β-thalassaemia	NG_000007.3	70468
3386	-76 C>A	N/A	HBB:c.-126C>A	β	Causative	β-thalassaemia	NG_000007.3	70469
3671	-76 C>T	N/A	HBB:c.-126C>T	β	Causative	β-thalassaemia	NG_000007.3	70469
15	-73 (A>T)	N/A	HBB:c.-123A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70472
3672	-73 A>C	N/A	HBB:c.-123A>C	β	Causative	β-thalassaemia	NG_000007.3	70472
3673	-73 A>G	N/A	HBB:c.-123A>G	β	Causative	β-thalassaemia	NG_000007.3	70472
2997	-72 T>A	N/A	HBB:c.-122T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70473
2171	-71 C>T	N/A	HBB:c.-121C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70474
3674	-63 A>G	N/A	HBB:c.-113A>G	β	Causative	β-thalassaemia	NG_000007.3	70482
16	-56 G>C	N/A	HBB:c.-106G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70489
17	-50 G>A	N/A	HBB:c.-100G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70495
3060	-42 C>G	N/A	HBB:c.-92C>G	β	Causative	β-thalassaemia	NG_000007.3	70503
2172	-41 A>T	N/A	HBB:c.-91A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70504
18	-32 (C>A)	N/A	HBB:c.-82C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70513
19	-32 (C>T)	N/A	HBB:c.-82C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70513
20	-31 (A>G)	N/A	HBB:c.-81A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70514
21	-31 (A>C)	N/A	HBB:c.-81A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70514
22	-30 (T>A)	N/A	HBB:c.-80T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70515
23	-30 (T>C)	N/A	HBB:c.-80T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70515
2179	-30 T>G	N/A	HBB:c.-80T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70515
3062	-30 (-T)	N/A	HBB:c.-80delT	β	Causative	β-thalassaemia	NG_000007.3	70515
24	-29 to -26 (-AA)	N/A	HBB:c.-79_78delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70516
25	-29 (A>G)	N/A	HBB:c.-79A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70516
26	-29 (A>C)	N/A	HBB:c.-79A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70516
28	-28 (A>C)	N/A	HBB:c.-78A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70517
29	-28 (A>G)	N/A	HBB:c.-78A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70517
30	-27 (A>T)	N/A	HBB:c.-77A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70518
31	-27 (-AA)	N/A	HBB:c.-77_-76delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70518
2175	-26 A>C	N/A	HBB:c.-76A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70519
32	-25 (G>C)	N/A	HBB:c.-75G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70520
2565	-25 G>T	N/A	HBB:c.-75G>T	β	Causative	β-thalassaemia	NG_000007.3	70520
282	105 bp deletion	N/A	HBB:c.-74_31del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70521
34	CAP +1 (A>C)	N/A	HBB:c.-50A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70545
3464	CAP +3 A>T	N/A	HBB:c.-48A>T	β	Causative	β-thalassaemia	NG_000007.3	70547
35	CAP +8 (C>T)	N/A	HBB:c.-43C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70552
36	CAP +10 (-T)	N/A	HBB:c.-41delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70554
3627	CAP +20 (-C)	N/A	HBB:c.-31delC	β	Causative	β-thalassaemia	NG_000007.3	70564
38	CAP +22 (G>A)	N/A	HBB:c.-29G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70566
3345	CAP +22 (G>T)	N/A	HBB:c.-29G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70566
3676	CAP +27 (C>G)	N/A	HBB:c.-24C>G	β	Causative	β-thalassaemia	NG_000007.3	70571
33	-22 to +23 (+45 bp duplication)	N/A	NG_000007.3:g.70573_70617dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70573
2536	CAP +30 T>A	N/A	HBB:c.-21T>A	β	Causative	β-thalassaemia	NG_000007.3	70574
39	CAP +33 (C>G)	N/A	HBB:c.-18C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70577
2176	CAP +39 C>T	N/A	NG_000007.3:g.70583C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70583
3600	CAP +39 (C>T)	N/A	HBB:c.-12C>T	β	Causative	β-thalassaemia	NG_000007.3	70583
40	CAP +41 to +44 (-AACA)	N/A	HBB:c.-10_-7delAACA	β	Causative	β-thalassaemia	NG_000007.3	70585
41	CAP +45 (G>C)	Hb Odisha	HBB:c.-6G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70589
42	Init CD ATG>GTG	N/A	HBB:c.1A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70595
43	Init CD ATG>CTG	N/A	HBB:c.1A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70595
44	Init CD ATG>ACG	N/A	HBB:c.2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
45	Init CD ATG>AGG	N/A	HBB:c.2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
46	Init CD ATG>AAG	N/A	HBB:c.2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
47	Init CD ATG>ATC	N/A	HBB:c.3G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
48	Init CD ATG>ATA	N/A	HBB:c.3G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
49	Init CD ATG>ATT	N/A	HBB:c.3G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
50	CD 1 (-G)	N/A	HBB:c.4delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70598
51	CD 2-4 (-9 bp, +31 bp)	N/A	HBB:c.8_16delinsCTGAGGTGAAGTCTGCCTGAGGAGAAGT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70602
3014	CD 2 CAT>C-T	N/A	HBB:c.8delA	β	Causative	β-thalassaemia	NG_000007.3	70602
3561	CD 2 CAT/CA-	N/A	HBB:c.9delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70603
52	CD 3 (+T)	N/A	HBB:c.11dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70605
55	CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG)	N/A	HBB:c.[15T>A;16C>T;19G>T]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70609, 70610, 70613
54	CD 5 -CT	N/A	HBB:c.17_18delCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70611
2180	CD 5/6 -TG	N/A	HBB:c.18_19delTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70612
56	CD 6 (GAG>TAG)	N/A	HBB:c.19G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
2184	CD 6-14 (-26 bp) (26 bp deletion)	N/A	HBB:c.20_45del26bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
57	CD 6 -A	N/A	HBB:c.20delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
58	CD 6 (-G)	N/A	HBB:c.20delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
59	CD 6-10 (-13 bp)	N/A	HBB:c.20_32del13	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
60	CD 7 GAG>TAG	N/A	HBB:c.22G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70616
3288	CD7 GAG>G-G	N/A	HBB:c.23delA	β	Causative	β-thalassaemia	NG_000007.3	70617
2958	CD 7/8 (+G)	N/A	HBB:c.24dupG	β	Causative	β-thalassaemia	NG_000007.3	70618
61	CD 8 (-AA)	N/A	HBB:c.25_26delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70619
2185	CD 8/9 +AGAA	N/A	HBB:c.27_28insAGAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70620
62	CD 8/9 (+G)	N/A	HBB:c.27dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
3513	CD 8 AAG>AA-	N/A	HBB:c.27delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
63	CD 9 (+TA)	N/A	HBB:c.28_29insTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70622
65	CD 10 (GCC>GCA)	N/A	HBB:c.33C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70627
66	CD 10 (-C)	N/A	HBB:c.33delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70627
67	CD 11 (-T)	N/A	HBB:c.36delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70630
3248	CD 13 GCC>GTC [Ala>Val]	N/A	HBB:c.41C>T	β	Causative	β-thalassaemia	NG_000007.3	70635
68	CD 14 (+T)	N/A	HBB:c.44dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
2553	CD 14 CTG>C-G	N/A	HBB:c.44delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
69	CD 14/15 (+G)	N/A	HBB:c.45dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70639
70	CD 15 (-T)	N/A	HBB:c.46delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70640
72	CD 15 TGG>TAG	N/A	HBB:c.47G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70641
73	CD 15 TGG>TGA	N/A	HBB:c.48G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70642
71	CD 15/16 (+G)	N/A	HBB:c.50dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
74	CD 15/16 (-G)	N/A	HBB:c.50delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
75	CD 16 GGC>GG-	N/A	HBB:c.51delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70645
76	CD 16 GGC>GGT [Gly>Gly]	N/A	HBB:c.51C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70645
3691	CD 16 (GGC>GG-)	N/A	HBB:c.51delC	β	Causative	β-thalassaemia	NG_000007.3	70645
77	CD 17 (AAG>TAG)	N/A	HBB:c.52A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70646
78	CD 17 (+A)	N/A	HBB:c.53dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70647
3609	CD 20/21 (-TGGA)	N/A	HBB:c.62_65delTGGA	β	Causative	β-thalassaemia	NG_000007.3	70656
80	CD 20-22 (GTGGATGAA>GTGAA)	N/A	HBB:c.64_67del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
81	CD 20/21 (+G)	N/A	HBB:c.64dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
83	CD 22 (GAA>TAA)	N/A	HBB:c.67G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70661
84	CD 22-24 ( -7 bp): (-AAGTTGG)	N/A	HBB:c.68_74delAAGTTGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70662
85	CD 24 (-G, +CAC)	N/A	HBB:c.74delinsCAC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
2174	CD 24 -G	N/A	HBB:c.74delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
86	CD 24 GGT>GGA [Gly>Gly]	N/A	HBB:c.75T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70669
281	IVS I [3 end] -44 bp (44 bp deletion)	N/A	HBB:c.76_92+27del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70670
87	CD 25/26 (+T)	N/A	HBB:c.78dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70672
89	CD 26 (GAG>TAG)	N/A	HBB:c.79G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
90	CD 26 (+T)	N/A	HBB:c.79_80insT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
3409	CD 26 GAG>AAG, IVS I-7 A>G	Hb E-Udon Thani	HBB:c.[79G>A;92+7A>G]	β	Causative	β-thalassaemia	NG_000007.3	70673, 70693
92	CD 27/28 (+C)	N/A	HBB:c.85dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
93	CD 28 (-C)	N/A	HBB:c.85delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
95	CD 28/29 (-G)	N/A	HBB:c.89delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70683
96	CD 29 (C>T) or IVS I (-3) GGC>GGT (Gly>Gly)	N/A	HBB:c.90C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70684
97	CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly)	N/A	HBB:c.91A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
98	CD 30 (A>C) or IVS I (-2) AGG>CGG [Arg>Arg]	N/A	HBB:c.91A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
3484	CD 30 (-A) or IVS I (-2) AGG>-GG	N/A	HBB:c.91delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
99	CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys)	N/A	HBB:c.92G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70686
101	IVS I-1 G>A	N/A	HBB:c.92+1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
102	IVS I-1 (G>T)	N/A	HBB:c.92+1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
103	IVS I-1 (G>C)	N/A	HBB:c.92+1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
104	IVS I-2 (T>G)	N/A	HBB:c.92+2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
105	IVS I-2 (T>C)	N/A	HBB:c.92+2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
106	IVS I-2 (T>A)	N/A	HBB:c.92+2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
107	IVS I-5 (G>C)	N/A	HBB:c.92+5G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70691
108	IVS I-5 (G>T)	N/A	HBB:c.92+5G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70691
109	IVS I-5 (G>A)	N/A	HBB:c.92+5G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70691
111	IVS I-6 (T>C)	N/A	HBB:c.92+6T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70692
3565	IVS I-6 (T>G)	N/A	HBB:c.92+6T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70692
112	IVS I-7 A>T	N/A	HBB:c.92+7A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70693
3276	IVS I-7 A>G	N/A	HBB:c.92+7A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70693
3690	IVS I-65 (G>A)	N/A	HBB:c.92+65G>A	β	Causative	β-thalassaemia	NG_000007.3	70751
2173	IVS I-109 (-T)	N/A	HBB:c.93-22delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70795
113	IVS I-110 G>A	N/A	HBB:c.93-21G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70796
280	IVS I [3' end] (-25 bp) (25 bp deletion)	N/A	HBB:c.93-21_96del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70796
121	IVS I [3' end] (-17 bp) (17 bp deletion)	N/A	HBB:c.93-17_93-1delTATTTTCCCACCCTTAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70800
3008	IVS I-115 (A>T)	N/A	HBB:c.93-16A>T	β	Causative	β-thalassaemia	NG_000007.3	70801
114	IVS I-116 (T>G)	N/A	HBB:c.93-15T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70802
124	IVS I [3' end] (+22bp)	N/A	NG_000007.3:g.70807_70828dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70807
115	IVS I-128 (T>G)	N/A	HBB:c.93-3T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70814
116	IVS I-129 (A>C)	N/A	HBB:c.93-2A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70815
117	IVS I-129 (A>G)	N/A	HBB:c.93-2A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70815
118	IVS I-130 G>C	N/A	HBB:c.93-1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70816
119	IVS I-130 (G>A)	N/A	HBB:c.93-1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70816
120	IVS I-130 (+1) or CD 30, (G>C); AGG>AGC (Arg>Ser)	N/A	HBB:c.93G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70817
126	CD 31 (-C)	N/A	HBB:c.94delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70818
130	CD 33-34 (-G)	N/A	HBB:c.102_103delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70826
132	CD 35 TAC>TGC [Tyr>Cys]	N/A	HBB:c.107A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70831
133	CD 35 TAC>TAA	N/A	HBB:c.108C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70832
3023	CD 35 TAC>TAG	N/A	HBB:c.108C>G	β	Causative	β-thalassaemia	NG_000007.3	70832
3692	CD 35 (TAC>TA-)	N/A	HBB:c.108delC	β	Causative	β-thalassaemia	NG_000007.3	70832
128	CD 36 CCT>C-T	N/A	HBB:c.110del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70834
135	CD 36-39 (-8 bp)	N/A	HBB:c.111_118delTTGGACCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70835
134	CD 36/37 (-T)	N/A	HBB:c.112delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70836
138	CD 37 (TGG>TAG)	N/A	HBB:c.113G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70837
136	CD 37 -G	N/A	HBB:c.114delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
137	CD 37 (TGG>TGA)	N/A	HBB:c.114G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
139	CD 37-39 (-7 bp): (-GACCCAG)	N/A	HBB:c.114_120delGACCCAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
141	CD 38/39 (-CC)	N/A	HBB:c.117_118delCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70841
140	CD 38/39 (-C)	N/A	HBB:c.118delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
142	CD 39 (CAG>TAG)	N/A	HBB:c.118C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
2393	CD 39 -A	N/A	HBB:c.119delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70843
143	CD 40 (-G)	N/A	HBB:c.123delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
144	CD 40 (+86 bp) (HGSA)	N/A	HBB:c.123_208dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
145	CD 40/41 (+T)	N/A	HBB:c.125dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70849
146	CD 41 (-C)	N/A	HBB:c.126delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
147	CD 41/42 (-CTTT)	N/A	HBB:c.126_129delCTTT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
148	CD 42/43 (+T)	N/A	HBB:c.129dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70853
149	CD 42/43 (+G)	N/A	HBB:c.130dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
150	CD 43 (GAG>TAG)	N/A	HBB:c.130G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
3594	CD 43 (GAG>TAG);CD 71/72 (+A)	N/A	HBB:c.[130G>T;217dupA]	β	Causative	β-thalassaemia	NG_000007.3	70854, 70941
151	CD 44 -C	N/A	HBB:c.135delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70859
152	CD 45 (-T)	N/A	HBB:c.138delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
153	CD 45 (+T)	N/A	HBB:c.138dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
154	CD 45/46 (+A)	N/A	HBB:c.138_139insA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
2960	CD 46/47 (+G)	N/A	HBB:c.142_142dupG	β	Causative	β-thalassaemia	NG_000007.3	70866
155	CD 47 (+A)	N/A	HBB:c.143dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
156	CD 47/48 (+ATCT)	N/A	HBB:c.143_146dupATCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
2187	CD 48 -T	N/A	HBB:c.146delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70870
157	CD 49 (-C)	N/A	HBB:c.150delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70874
3571	CD 50 ACT>GCT [Thr>Ala]	N/A	HBB:c.151A>G	β	Causative	β-thalassaemia	NG_000007.3	70875
158	CD 50 (-T)	N/A	HBB:c.153delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70877
159	CD 51 (-C)	N/A	HBB:c.155delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70879
2959	CD 52 GAT>G-T	N/A	HBB:c.158delA	β	Causative	β-thalassaemia	NG_000007.3	70882
160	CD 53 (-T)	N/A	HBB:c.162delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70886
161	CD 53/54 (+G)	N/A	HBB:c.163dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70887
162	CD 54 -T	N/A	HBB:c.165delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
164	CD 54-58 (-13bp)	N/A	HBB:c.165_177delTATGGGCAACCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
163	CD 54/55 (+A)	N/A	HBB:c.166dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
165	CD 55 (-A)	N/A	HBB:c.166delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
2990	CD 55-59 (-13 bp)	N/A	HBB:c.167_179del	β	Causative	β-thalassaemia	NG_000007.3	70891
166	CD 56-60 +14 bp	N/A	HBB:c.170_171insGCAACCCTAAGGTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70894
167	CD 57/58 (+C)	N/A	HBB:c.176dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70900
3311	CD 58 CCT>C-T	N/A	HBB:c.176delC	β	Causative	β-thalassaemia	NG_000007.3	70900
169	CD 59 (AAG>TAG)	N/A	HBB:c.178A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70902
3061	CD 59 (+T)	N/A	HBB:c.178_179insT	β	Causative	β-thalassaemia	NG_000007.3	70902
168	CD 59 -A	N/A	HBB:c.179delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70903
172	CD 61 (AAG>TAG)	N/A	HBB:c.184A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70908
2431	CD 61/62 +65 bp	N/A	HBB:c.187_251dup	β	Causative	β-thalassaemia, Haemolytic anaemia	NG_000007.3	70911
3589	CD 62-65 (-12bp)	N/A	HBB:c.187_198delGCTCATGGCAAG	β	Causative	β-thalassaemia, Haemolytic anaemia	NG_000007.3	70911
171	CD 62-64 (-7 bp)	N/A	HBB:c.189_195delTCATGGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70913
3100	CD 62-64 (-7bp): (-TCATGGC)	N/A	HBB:c.189_195delTCATGGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70913
173	CD 64 (-G)	N/A	HBB:c.194delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70918
174	CD 66 (AAA>TAA)	N/A	HBB:c.199A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70923
2188	CD 66 -A	N/A	HBB:c.201delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70925
175	CD 67 (-TG)	N/A	HBB:c.203_204delGT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70927
3019	CD 68-70 (-7bp): (-TCGGTGC)	N/A	HBB:c.206_212delTCGGTGC	β	Causative	β-thalassaemia	NG_000007.3	70930
2522	CD 69 GGT>G-T	N/A	HBB:c.209delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70933
2189	CD 69 -T	N/A	HBB:c.210delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70934
176	CD 71 (+T)	N/A	HBB:c.216dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70940
2462	CD 71 -T	N/A	HBB:c.216delT	β	Causative	β-thalassaemia	NG_000007.3	70940
177	CD 71/72 (+A)	N/A	HBB:c.217dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
178	CD 72-73 (-AGTGA, +T)	N/A	HBB: c.217_221delAGTGAinsT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
2181	CD 72/73 (+T)	N/A	HBB:c.219dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70943
3374	CD 72 AGT>AGA [Ser>Arg]; CD 73 GAT>TAT [Asp>Tyr]	Hb South China	HBB:c.[219T>A;220G>T]	β	Causative	β-thalassaemia	NG_000007.3	70943, 70944
179	CD 74/75 (-C)	N/A	HBB:c.225delC or HBB:c.226delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70949
180	CD 76 GCT>--T (-GC)	N/A	HBB:c.229_230delGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70953
181	CD 76 (-C)	N/A	HBB:c.230delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70954
182	CD 77/78 (-C)	N/A	HBB:c.232delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70956
3299	CD 77/78 (+C)	N/A	HBB:c.235dupC	β	Causative	β-thalassaemia	NG_000007.3	70959
3225	CD 78/85 (-20bp)	N/A	HBB:c.237_256delGGACAACCTCAAGGGCACCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70961
183	CD 80/81 (-C)	N/A	HBB:c.244delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
184	CD 81-87 (-22 bp)	N/A	HBB:c.244_265del22	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
185	CD 82/83 (-G)	N/A	HBB:c.251delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70975
2190	CD 83 (+65 bp duplication)	N/A	HBB:c.187_251dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70975
2484	CD 83/84 +65 bp	N/A	HBB:c.252_253insNG_000007.3:g.70911_70975	β	Causative	β-thalassaemia	NG_000007.3	70976
186	CD 84-86 (-8 bp): (-CACCTTTG)	N/A	HBB:c.253_260del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70977
187	CD 84/85 (+C)	N/A	HBB:c.255dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70979
188	CD 84-86 (+T)	N/A	HBB:c.258dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70982
3253	CD 88 CTG>--G (HBB:c.265_266delCT)	N/A	HBB:c.265_266del	β	Causative	β-thalassaemia	NG_000007.3	70989
189	CD 88 (+T)	N/A	HBB:c.266dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
190	CD 88 (-TG)	N/A	HBB:c.266_267del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
3287	CD 89-93 (-14bp): (-AGTGAGCTGCACTG)	N/A	HBB:c.268_281delAGTGAGCTGCACTG	β	Causative	β-thalassaemia	NG_000007.3	70992
191	CD 89/90 (AGTGAG>AGAG)	N/A	HBB:c.270_271del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70994
192	CD 90 GAG>TAG	N/A	HBB:c.271G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70995
3044	CD 90 GAG>-AG	N/A	HBB:c.271delG	β	Causative	β-thalassaemia	NG_000007.3	70995
3057	CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG)	N/A	HBB:c.272_295dup	β	Causative	β-thalassaemia	NG_000007.3	70996
3133	IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu]	N/A	HBB:c.[315+1G>A; 274C>T]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70998, 71040
194	CD 91 (+T)	N/A	HBB:c.275dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
196	CD 95 (+A)	N/A	HBB:c.287dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71011
2279	CD 102 AAC>ATCAC	N/A	HBB:c.308insTC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71032
3636	CD 104 (-A)	N/A	HBB:c.313delA	β	Causative	β-thalassaemia	NG_000007.3	71037
200	IVS II-1 G>A	N/A	HBB:c.315+1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
201	IVS II-1 G>C	N/A	HBB:c.315+1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
202	IVS II-1 G>T	N/A	HBB:c.315+1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
203	IVS II-2 T>C	N/A	HBB:c.315+2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
204	IVS II-2 (T>A)	N/A	HBB:c.315+2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
205	IVS II-2 (-T)	N/A	HBB:c.315+2del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
2182	IVS II-2 -TGAGTCTATGGG	N/A	HBB:c.315+2_315+13delTGAGTCTATGGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
3226	IVS II-2 T>G	N/A	HBB:c.315+2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
207	IVS II 4/5 -AG	N/A	NG_000007.3:g.71043_71044delAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71043
208	IVS II-5 (G>C)	N/A	HBB:c.315+5G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71044
3677	IVS II-15 (C>T)	N/A	HBB:c.315+15C>T	β	Causative	β-thalassaemia	NG_000007.3	71054
3678	IVS II-45 (A>G)	N/A	HBB:c.315+45A>G	β	Causative	β-thalassaemia	NG_000007.3	71084
3681	IVS II-63 (T>C)	N/A	HBB:c.315+63T>C	β	Causative	β-thalassaemia	NG_000007.3	71102
3680	IVS II-70 (G>A)	N/A	HBB:c.315+70G>A	β	Causative	β-thalassaemia	NG_000007.3	71109
3679	IVS II-129 (G>A)	N/A	HBB:c.315+129G>A	β	Causative	β-thalassaemia	NG_000007.3	71168
3682	IVS II-180 (T>C)	N/A	HBB:c.315+180T>C	β	Causative	β-thalassaemia	NG_000007.3	71219
3683	IVS II-308 (-A)	N/A	HBB:c.315+308delA	β	Causative	β-thalassaemia	NG_000007.3	71347
3684	IVS II-478 (C>A)	N/A	HBB:c.316-373C>A	β	Causative	β-thalassaemia	NG_000007.3	71517
286	619 bp deletion (Asian Indian)	N/A	NG_000007.3:g.71609_72227del619	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71609
210	IVS II-613 C>T	N/A	HBB:c.316-238C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71652
3685	IVS II-613 (C>T)	N/A	HBB:c.316-238C>T	β	Causative	β-thalassaemia	NG_000007.3	71652
3391	IVS-II-648/649 (-T)	N/A	HBB:c.316-202del	β	Causative	β-thalassaemia	NG_000007.3	71688
211	IVS II-654 C>T	N/A	HBB:c.316-197C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71693
3686	IVS II-672 (A>C)	N/A	HBB:c.316-179A>C	β	Causative	β-thalassaemia	NG_000007.3	71711
212	IVS II-705 (T>G)	N/A	HBB:c.316-146T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71744
213	IVS II-726 A>G	N/A	HBB:c.316-125A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71765
214	IVS II-745 C>G	N/A	HBB:c.316-106C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71784
215	IVS II-761 A>G	N/A	HBB:c.316-90A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71800
2200	IVS II-765 L1 insertion	N/A	HBB:c.316-86_316-85insCTGCTTTTATTTT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71804
2183	IVS II-781 C>G	N/A	HBB:c.316-70C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71820
3687	IVS II-806 (G>C)	N/A	HBB:c.316-45G>C	β	Causative	β-thalassaemia	NG_000007.3	71845
3616	IVS II-809 (-G)	N/A	HBB:c.316-42delG	β	Causative	β-thalassaemia	NG_000007.3	71848
216	IVS II-815 (C>T)	N/A	HBB:c.316-36C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71854
3558	IVS II-821 (A>C)	N/A	HBB:c.316-30A>C	β	Causative	β-thalassaemia	NG_000007.3	71860
217	IVS II-837 (T>G)	N/A	HBB:c.316-14T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71876
218	IVS II-843 (T>G)	N/A	HBB:c.316-8T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71882
219	IVS II-844 (C>A)	N/A	HBB:c.316-7C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71883
220	IVS II-844 (C>G)	N/A	HBB:c.316-7C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71883
221	IVS II-848 (C>A)	N/A	HBB:c.316-3C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71887
222	IVS II-848 (C>G)	N/A	HBB:c.316-3C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71887
3045	IVS II-848 C>T	N/A	HBB: c.316-3C>T	β	Causative	β-thalassaemia	NG_000007.3	71887
223	IVS II-849 (A>G)	N/A	HBB:c.316-2A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71888
224	IVS II-849 (A>C)	N/A	HBB:c.316-2A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71888
225	IVS II-850 G>C	N/A	HBB:c.316-1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
226	IVS II-850 (G>A)	N/A	HBB:c.316-1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
227	IVS II-850 (G>T)	N/A	HBB:c.316-1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
228	IVS II-850 (-G)	N/A	HBB:c.316-1delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
231	CD 106/107 (+G)	N/A	HBB:c.323dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
2191	CD 107-111 (-12 bp)	N/A	HBB:c.323_334delGGCAACGTGCTGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
3344	CD 107 +G	N/A	HBB:c.323dupG	β	Causative	β-thalassaemia	NG_000007.3	71897
3024	CD 111-115 (-12bp): (-TCTGTGTGCTGG)	N/A	HBB:c.335-346del12bp	β	Causative	β-thalassaemia	NG_000007.3	71909
235	CD 112 (TGT>TGA)	N/A	HBB:c.339T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
2192	CD 114/115 (+TGTGCTG)	N/A	HBB:c.339_345dupTGTGCTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
240	CD 116 (+TGAT)	N/A	HBB:c.349_350insTGAT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71924
3651	CD 117 CAC>CAG [His>Gln]	Hb Murcia	HBB:c.354C>G	β	Causative	β-thalassaemia	NG_000007.3	71928
3555	CD 124 (+C)	N/A	HBB:c.374dup	β	Causative	β-thalassaemia, Haemolytic anaemia	NG_000007.3	71948
2194	CD 124/125 (+A)	N/A	HBB:c.375dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
2195	CD 125-127 (-CAGTGC)	N/A	HBB:c.377_382delCAGTGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71951
3563	CD 126 GTG>-TG	N/A	HBB:c.379delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71953
2196	CD 130 TAT>TAA	N/A	HBB:c.393T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71967
258	CD 131 (CAG>TAG)	N/A	HBB:c.394C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71968
2197	CD 131 (+A)	N/A	HBB:c.395dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71969
259	CD 131/132 (+GCCT)	N/A	HBB:c.396_397insGCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
262	CD 132 (AAA>TAA)	N/A	HBB:c.397A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71971
3361	CD 138/139 (+T)	N/A	HBB:c.417dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71991
267	Terminal CD +6 C>G [CAP +1480]	N/A	HBB:c.*6C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72024
3688	3'UTR +21 A>G	N/A	HBB:c.*21A>G	β	Causative	β-thalassaemia	NG_000007.3	72039
2177	Terminal CD +32 A>C	N/A	HBB:c.*32A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72050
268	Terminal CD +47 C>G	N/A	HBB:c.*47C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72065
269	3'UTR -13 bp [CAP +1567 to +1579]	N/A	HBB:c.93_105delATCTGGATTCTGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72111
3048	3' UTR, +C, -TGGATTCT	N/A	HBB:c.96_103delTGGATTCTinsC	β	Causative	β-thalassaemia	NG_000007.3	72113
3443	Cap +1570 (T>C)	N/A	HBB:c*96T>C	β	Causative	β-thalassaemia	NG_000007.3	72114
270	Poly A (A>C) AATAAA>CATAAA	N/A	HBB:c.*108A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72126
271	Poly A (A>G) AATAAA>GATAAA	N/A	HBB:c.*108A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72126
272	Poly A (T>C) AATAAA>AACAAA	N/A	HBB:c.*110T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
273	Poly A (T>A) AATAAA>AAAAAA	N/A	HBB:c.*110T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
277	Poly A (-TA); (AATAAA>AAAA)	N/A	HBB:c.110_111delTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
278	Poly A (-AATAA) (polyA (-TAAAA))	N/A	HBB:c.110_114del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
274	Poly A (A>G) AATAAA>AATGAA	N/A	HBB:c.*111A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72129
2199	Poly A (-AA) AATAAA>AAT--A	N/A	NG_000007.3:g.72129_72130delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72129
275	Poly A (A>G) AATAAA>AATAGA	N/A	HBB:c.*112A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72130
2198	Poly A (A>T) AATAAA>AATATA	N/A	HBB:c.*112A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72130
276	Poly A (A>G) AATAAA>AATAAG	N/A	HBB:c.*113A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72131
3046	Poly A (-AA)	N/A	HBB:c.115_116delAA	β	Causative	β-thalassaemia	NG_000007.3	72133
2564	3'UTR +1592 (A>G)	N/A	HBB:c.*118A>G	β	Causative	β-thalassaemia	NG_000007.3	72136
3605	3' UTR +1606 (C>T)	N/A	HBB:c.*132C>T	β	Causative	β-thalassaemia	NG_000007.3	72150
2463	3' UTR +101 G>C	N/A	HBB:c.*233G>C	β	Causative	β-thalassaemia	NG_000007.3	72251
3689	3'UTR +261 T>C	N/A	HBB:c.*261T>C	β	Causative	β-thalassaemia	NG_000007.3	72279

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.