IthaGenes

Loading... Please wait!

Quick filtering

Showing all entries with the following effect: frameshift (Show All):

IthaID	Common Name	Hb Name	HGVS Name	Genes	Functionality	Phenotype	Locus	Position
4071	CD 1 (-G)	N/A	HBA2:c.4del	α2	Causative	α-thalassaemia	NG_000006.1	33779
3720	CD 1/2 (+TG)	N/A	HBA2:c.6_7insTG	α2	Causative	α-thalassaemia	NG_000006.1	33781
2206	CD 8 (-C)	N/A	HBA2:c.27delC	α2	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	33802
3714	CD 15/16 (+T)	N/A	HBA2:c.48_49insT	α2	Causative	α-thalassaemia	NG_000006.1	33823
3885	CD 17 (-C) (Hb Kunming)	N/A	HBA2:c.54delC	α2	Causative	α-thalassaemia	NG_000006.1	33829
350	CD 18 GGC>G-C	N/A	HBA2:c.56delG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33831
2465	CD 19 GCG>GC-	N/A	HBA2:c.60delG	α2	Causative	α-thalassaemia	NG_000006.1	33835
2207	CD 21/22 +T	N/A	HBA2:c.66dupT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33841
353	CD 22 -C	N/A	HBA2:c.69delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	33844
3568	CD 28 GCC>-CC	N/A	HBA2:c.85delG	α2	Causative	α-thalassaemia	NG_000006.1	33860
3745	IVS I-1 G>A	N/A	HBA2:c.95+1G>A	α2	Causative	α-thalassaemia	NG_000006.1	33871
2211	CD 37 CCC>CC-	N/A	HBA2:c.114delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34006
372	CD 39-41 (-9 bp, + 8 bp)	N/A	NG_000006.1:g.34010_34018delinsTACTTCCC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34010
2493	CD 40 AAG>AA-	N/A	HBA2:c.123delG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34015
2214	CD 43 TTC>T-C	N/A	HBA2:c.131delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34023
2215	CD 43/44 -C	N/A	HBA2:c.132delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34024
3405	CD 47-53 (-20bp): (-GACCTGAGCCACGGCTCTGC)	N/A	HBA2:c.142_161del	α2	Causative	α-thalassaemia	NG_000006.1	34034
2216	CD 47 -A	N/A	HBA2:c.143delA	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34035
3053	CD 47/48 (-4bp): (-ACCT)	N/A	HBA2:c.143_146delACCT	α2	Causative	α-thalassaemia	NG_000006.1	34035
374	CD 49 -GC	N/A	HBA2:c.149_150delGC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34041
2217	CD 51/52 +G	N/A	HBA2:c.156_157insG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34048
3079	CD 55 +T	N/A	HBA2:c.168dup	α2	Causative	α-thalassaemia	NG_000006.1	34060
3054	CD 56 AAG>--G	N/A	HBA2:c.169_170delAA	α2	Causative	α-thalassaemia	NG_000006.1	34061
2576	CD 68 AAC>A-C	N/A	HBA2:c.206delA	α2	Causative	α-thalassaemia	NG_000006.1	34098
4070	CD 68 (-C)	N/A	HBA2:c.207del	α2	Causative	α-thalassaemia	NG_000006.1	34099
3705	CD 72 (+C)	N/A	HBA2:c.217dup	α2	Causative	α-thalassaemia	NG_000006.1	34109
3055	CD 73/74 (-4bp): (-GTGG)	N/A	HBA2:c.220_223delGTGG	α2	Causative	α-thalassaemia	NG_000006.1	34112
3632	CD 76/77 (+T)	N/A	HBB:c.231_232insT	α2	Causative	α-thalassaemia	NG_000006.1	34123
3974	CD 82-83 (-CCTG)	N/A	HBA2:c.249_252del	α2	Causative	α-thalassaemia	NG_000006.1	34141
644	CD 87 +9 bp [+Ser-Asp-Leu]	Hb Neuilly-sur-Marne	HBA1:c.253_261dup \| HBA2:c.253_261dup	α1 or α2	Causative	α-chain variant	NG_000006.1	34154, 37949
3569	CD 89-93 (-13bp): (-CACAAGCTTCGGG)	N/A	HBA2:c.268_280delCACAAGCTTCGGG	α2	Causative	α-thalassaemia	NG_000006.1	34160
3572	CD 90‐92 (-8bp): (‐AGCTTCGG)	N/A	HBA2:c.272_279delAGCTTCGG	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34164
2436	CD 107 GTG>G-G	Hb Lynwood	HBA2:c.323delT	α2	Causative	α-thalassaemia, α-chain variant	NG_000006.1	34357
398	CD 109 (-C)	Hb Sciacca	HBA1:c.328delC	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	34362
721	CD 116-117 +15 bp [+His-Leu-Pro-Ala-Glu]	Hb Zaïre	HBA1:c.337_351dup \| HBA2:c.337_351dup	α1 or α2	Causative	α-chain variant	NG_000006.1	34371, 38182
4068	CD 112 CAC>-AC	N/A	HBA2:c.337delC	α2	Causative	α-thalassaemia	NG_000006.1	34371
402	CD 112/113 -C	N/A	HBA2:c.339delC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34373
404	CD 113-116 (-12 bp) & CD 112 (C>G)	Hb Leida	HBA2:c.[339C>G;340_351delCTCCCCGCCGAG]	α2	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	34373
2527	CD 114 (+CC)	N/A	HBA2:c.344_345dup	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34378
3140	CD 114 CCC>CC-	N/A	HBA2:c.345delC	α2	Causative	α-thalassaemia	NG_000006.1	34379
2221	CD 115 -GAGTTCACCCC [166 aa]	N/A	HBA2:c.349_359delGAGTTCACCCC	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	34383
3862	CD 125 (+C)	N/A	HBA2:c.376dupC	α2	Causative	α-thalassaemia	NG_000006.1	34410
3305	CD 126 GCG>-CG	N/A	HBA2:c.379delG	α2	Causative	α-thalassaemia	NG_000006.1	34413
2480	CD 129 CTG>-TG	Hb Hamilton Hill	HBA2:c.388delC	α2	Causative	α-chain variant	NG_000006.1	34422
4085	CD 132 (+T)	Hb Balkh	HBA2:c.398dup	α2	Causative	α-chain variant	NG_000006.1	34432
3404	CD 133-135 (-AGCACCG)	Hb Aalesund	HBA2:c.400_406del	α2	Causative	α-chain variant	NG_000006.1	34434
775	CD 139 (-A)	Hb Wayne	HBA2:c.420delA	α2	Causative	α-chain variant	NG_000006.1	34454
4006	CD 7 AAG>A-G (g.188 (GenBank MK600512.1))	N/A	HBA1:c.23delA	α1	Causative	α-thalassaemia	NG_000006.1	37602
2205	CD 20 +T	N/A	HBA1:c.62_63insT	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37641
4077	CD 37 CCC>CC-	N/A	HBA1:c.114del	α1	Causative	α-thalassaemia	NG_000006.1	37810
3403	CD 39 +A	N/A	HBA2:c.118_119insA	α2	Causative	α-thalassaemia	NG_000006.1	37814
2468	CD 44 +C	N/A	HBA1:c.134_135insC	α1	Causative	α-thalassaemia	NG_000006.1	37830
375	CD 51-55 (-13 bp deletion)	N/A	HBA1:c.155_167delGCTCTGCCCAGGT	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37851
3717	CD 61 AAG>-AG	N/A	HBA1:c.184del	α1	Causative	α-thalassaemia	NG_000006.1	37880
382	CD 62 GTG>-TG	Hb Champaign	HBA1:c.187delG	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	37883
2347	CD 62 -G	N/A	HBA1:c.189delG	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37885
3373	CD 67 ACC>-CC	N/A	HBA1:c.202delA	α1	Causative	α-thalassaemia	NG_000006.1	37898
3326	CD 73 GTG>G-G	N/A	HBA1:c.221delT	α1	Causative	α-thalassaemia	NG_000006.1	37917
386	CD 78 -C	N/A	HBA1:c.237delC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37933
2219	CD 81 -T	N/A	HBA2:c.244delT	α2	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	37940
3861	CD 87 (-A)	N/A	HBA1:c.263delA	α1	Causative	α-thalassaemia	NG_000006.1	37959
4093	CD 95 (-C)	Hb Campania	HBA1:c.287delC	α1	Causative	α-thalassaemia, α-chain variant	NG_000006.1	37983
2224	CD 110-114 (-13 bp)	N/A	HBA1:c.333_345delCGCCCACCTCCCC	α1	Causative	α-thalassaemia, Haemolytic anaemia	NG_000006.1	38178
723	CD 118-119 +9 bp [+Glu-Phe-Thr] (Hb Dakar)	Hb Grady	HBA1:c.349_357dup	α1	Causative	α-chain variant	NG_000006.1	38194
3281	CD 130 (+T)	Hb Sichuan	HBA1:c.393_394insT	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	38238
416	CD 131 (+T) >175aa	Hb Pak Num Po	HBA1:c.396dup	α1	Causative	α-thalassaemia, α-chain variant, Haemolytic anaemia	NG_000006.1	38241
753	CD 131 TCT>TC-	Hb Fez	HBA1:c.396delT	α1	Causative	α-chain variant	NG_000006.1	38241
4084	CD 133-135 (-7 bp, -GCACCGT)	N/A	HBA1:c.401_407del	α1	Causative	α-thalassaemia	NG_000006.1	38246
760	CD 134 -C	Hb Senlis	HBA1:c.404delC	α1	Causative	α-chain variant, Haemolytic anaemia	NG_000006.1	38249
3483	CD 121 GAA>-AA	Hb Mahasarakham	HBB:c.364delG	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	6394
3232	CD 10 GCT>-CT	N/A	HBD:c.31delG	δ	Causative	δ-thalassaemia	NG_000007.3	63213
3806	CD 44-48 (-CTTTGGGGATC) (p.Phe46Valfs*4)	N/A	HBD:c.135_145del	δ	Causative	δ-thalassaemia	NG_000007.3	63445
2575	CD 58 +C	N/A	HBD:c.176_177insC	δ	Causative	δ-thalassaemia	NG_000007.3	63486
3441	CD 59 AAG>A-G (δ0 59 (-A))	N/A	HBD:c.179delA	δ	Causative	δ-thalassaemia	NG_000007.3	63489
3237	CD 59/60 (+GG)	N/A	HBD:c.180_181dup	δ	Causative	δ-thalassaemia	NG_000007.3	63490
3236	CD 87 CAG>C-G	N/A	HBD:c.263delA	δ	Causative	δ-thalassaemia	NG_000007.3	63573
3975	CD 98 (-GTG, +A)	N/A	HBD:c.295_297delGTGinsA	δ	Causative	δ-thalassaemia	NG_000007.3	63605
2521	CD 110-111 +GT	N/A	HBD:c.333_334insGT	δ	Causative	δ-thalassaemia, δ-chain variant	NG_000007.3	64541
3234	CD 113 (+TG)	N/A	HBD:c.341_342dupTG	δ	Causative	δ-thalassaemia	NG_000007.3	64549
3546	CD 130 TAT>-AT	Hb A2-Gaslini 1	HBD:c.391delT	δ	Causative	δ-chain variant	NG_000007.3	64599
3752	-99 to -85 (-15bp)	N/A	HBB:c.-149_-135delGTGGAGCCACACCCT	β	Causative	β-thalassaemia	NG_000007.3	70446
50	CD 1 (-G)	N/A	HBB:c.4delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70598
51	CD 2-4 (-9 bp, +31 bp)	N/A	HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
3437	CD 2 CAT>-AT	Hb Bundelkhand	HBB:c.7delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
3014	CD 2 CAT>C-T	N/A	HBB:c.8delA	β	Causative	β-thalassaemia	NG_000007.3	70602
3561	CD 2 CAT/CA-	N/A	HBB:c.9delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70603
52	CD 3 (+T)	N/A	HBB:c.11dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70605
3817	CD 4 (-T)	N/A	HBB:c.14delC	β	Causative	β-thalassaemia	NG_000007.3	70608
54	CD 5 -CT	N/A	HBB:c.17_18delCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70611
2180	CD 5/6 -TG	N/A	HBB:c.18_19delTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70612
2184	CD 6-14 (-26 bp) (26 bp deletion)	N/A	HBB:c.20_45del26bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
57	CD 6 -A	N/A	HBB:c.20delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
58	CD 6 (-G)	N/A	HBB:c.20delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
59	CD 6-10 (-13 bp)	N/A	HBB:c.21_33delGGAGAAGTCTGCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70615
3288	CD7 GAG>G-G	N/A	HBB:c.23delA	β	Causative	β-thalassaemia	NG_000007.3	70617
2958	CD 7/8 (+G)	N/A	HBB:c.24dupG	β	Causative	β-thalassaemia	NG_000007.3	70618
61	CD 8 (-AA)	N/A	HBB:c.25_26delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70619
2185	CD 8/9 +AGAA	N/A	HBB:c.27_28insAGAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70620
62	CD 8/9 (+G)	N/A	HBB:c.27dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
63	CD 9 (+TA)	N/A	HBB:c.28_29insTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70622
64	CD 9/10 (+T)	Hb Gaziantep	HBB:c.30dupT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70624
3399	CD 9 TCT>TC-	Hb Antep	HBB:c.30delT	β	Causative	β-chain variant	NG_000007.3	70624
4108	CD 10 GCC>GTC [Ala>Val]	N/A	HBB:c.31_32insT	β	Causative	β-thalassaemia	NG_000007.3	70625
66	CD 10 (-C)	N/A	HBB:c.33delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70627
67	CD 11 (-T)	N/A	HBB:c.36delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70630
3721	CD 14 CTG>-TG	N/A	HBB:c.43delC	β	Causative	β-thalassaemia	NG_000007.3	70637
68	CD 14 (+T)	N/A	HBB:c.44dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
2553	CD 14 CTG>C-G	N/A	HBB:c.44delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
69	CD 14/15 (+G)	N/A	HBB:c.45dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70639
70	CD 15 (-T)	N/A	HBB:c.46delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70640
71	CD 15/16 (+G)	N/A	HBB:c.50dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
74	CD 15/16 (-G)	N/A	HBB:c.50delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
75	CD 16 GGC>GG-	N/A	HBB:c.51delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70645
78	CD 17 (+A)	N/A	HBB:c.53dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70647
3609	CD 20/21 (-TGGA)	N/A	HBB:c.62_65delTGGA	β	Causative	β-thalassaemia	NG_000007.3	70656
80	CD 20-22 (GTGGATGAA>GTGAA)	N/A	HBB:c.64_67del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
81	CD 20/21 (+G)	N/A	HBB:c.64dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
84	CD 22-24 ( -7 bp): (-AAGTTGG)	N/A	HBB:c.68_74delAAGTTGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70662
872	CD 22-26 (-12bp)	Hb Olinda	HBB:c.69_80delAGTTGGTGGTGA	β	Causative	β-chain variant	NG_000007.3	70663
878	CD 23/24 (GTTGGT>GGT)	Hb Freiburg	HBB:c.71_73del	β	Causative	β-chain variant	NG_000007.3	70665
85	CD 24 (-G, +CAC)	N/A	HBB:c.74delinsCAC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
2174	CD 24 -G	N/A	HBB:c.74delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
87	CD 25/26 (+T)	N/A	HBB:c.78dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70672
90	CD 26 (+T)	N/A	HBB:c.79_80insT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
92	CD 27/28 (+C)	N/A	HBB:c.85dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
93	CD 28 (-C)	N/A	HBB:c.85delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
95	CD 28/29 (-G)	N/A	HBB:c.89delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70683
280	IVS I [3' end] (-25 bp) (25 bp deletion)	N/A	NC_000011.10(NM_000518.4):c.93-22_95del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70795
124	IVS I [3' end] (+22bp)	N/A	NG_000007.3:g.70807_70828dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70807
126	CD 31 (-C)	N/A	HBB:c.94delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70818
130	CD 33-34 (-G)	N/A	HBB:c.102_103delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70826
128	CD 36 CCT>C-T (CD 36 (-C))	N/A	HBB:c.110del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70834
135	CD 36-39 (-8 bp)	N/A	HBB:c.111_118delTTGGACCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70835
134	CD 36/37 (-T)	N/A	HBB:c.112delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70836
136	CD 37 (-G)	N/A	HBB:c.114delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
139	CD 37-39 (-7 bp): (-GACCCAG)	N/A	HBB:c.114_120del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
141	CD 38/39 (-CC)	N/A	HBB:c.117_118delCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70841
140	CD 38/39 (-C)	N/A	HBB:c.118delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
2393	CD 39 -A	N/A	HBB:c.119delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70843
143	CD 40 (-G)	N/A	HBB:c.123delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
144	CD 40 (+86 bp) (HGSA)	N/A	HBB:c.123_208dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
145	CD 40/41 (+T)	N/A	HBB:c.125dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70849
146	CD 41 (-C)	N/A	HBB:c.126delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
147	CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT))	N/A	HBB:c.126_129delCTTT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
148	CD 42/43 (+T)	N/A	HBB:c.129dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70853
2954	CD 42 TTT>TT-	Hb Yala	HBB:c.129delT	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	70853
149	CD 42/43 (+G)	N/A	HBB:c.130dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
150	CD 43 (GAG>TAG)	N/A	HBB:c.130G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
3594	CD 43 (GAG>TAG);CD 71/72 (+A)	N/A	HBB:c.[130G>T;217dupA]	β	Causative	β-thalassaemia	NG_000007.3	70854, 70941
946	CD 43-46 (-9bp)	Hb Niteroi	HBB:c.131_139del	β	Causative	β-chain variant, Haemolytic anaemia	NG_000007.3	70855
151	CD 44 -C	N/A	HBB:c.135delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70859
152	CD 45 (-T)	N/A	HBB:c.138delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
153	CD 45 (+T)	N/A	HBB:c.138dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
154	CD 45/46 (+A)	N/A	HBB:c.138_139insA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
2960	CD 46/47 (+G)	N/A	HBB:c.142_142dupG	β	Causative	β-thalassaemia	NG_000007.3	70866
155	CD 47 (+A)	N/A	HBB:c.143dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
156	CD 47/48 (+ATCT)	N/A	HBB:c.143_146dupATCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
2187	CD 48 -T	N/A	HBB:c.146delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70870
2407	CD 49-55 (-19 bp +4 bp)	Hb Martinez	HBB:c.149_167delinsAGCT	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	70873
157	CD 49 (-C)	N/A	HBB:c.150delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70874
158	CD 50 (-T)	N/A	HBB:c.153delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70877
159	CD 51 (-C)	N/A	HBB:c.155delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70879
2959	CD 52 GAT>G-T	N/A	HBB:c.158delA	β	Causative	β-thalassaemia	NG_000007.3	70882
160	CD 53 (-T)	N/A	HBB:c.162delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70886
161	CD 53/54 (+G)	N/A	HBB:c.163dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70887
4094	CD 54 GTT>-TT	N/A	HBB:c.163del	β	Causative	β-thalassaemia	NG_000007.3	70887
162	CD 54 -T	N/A	HBB:c.165delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
164	CD 54-58 (-13bp)	N/A	HBB:c.165_177delTATGGGCAACCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
163	CD 54/55 (+A)	N/A	HBB:c.166dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
165	CD 55 (-A)	N/A	HBB:c.166delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
2990	CD 55-59 (-13 bp)	N/A	HBB:c.167_179del	β	Causative	β-thalassaemia	NG_000007.3	70891
166	CD 56-60 (+14 bp)	N/A	HBB:c.170_183dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70894
989	CD 56-60 (-12bp)	Hb Tochigi	HBB:c.170_181del	β	Causative	β-chain variant	NG_000007.3	70894
167	CD 58 (+C)	N/A	HBB:c.176dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70900
3311	CD 58 CCT>C-T	N/A	HBB:c.176delC	β	Causative	β-thalassaemia	NG_000007.3	70900
3061	CD 59 (+T)	N/A	HBB:c.178_179insT	β	Causative	β-thalassaemia	NG_000007.3	70902
168	CD 59 -A	N/A	HBB:c.179delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70903
4086	CD 59 AAG>AA-, CD 59 (-G)	N/A	HBB:c.180del	β	Causative	β-thalassaemia	NG_000007.3	70904
171	CD 62-64 (-7bp)	N/A	HBB:c.189_195delTCATGGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70913
173	CD 64 (-G)	N/A	HBB:c.194delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70918
3944	CD 64 (+G)	N/A	HBB:c.194dup	β	Causative	β-thalassaemia	NG_000007.3	70918
3854	CD 66/67 (-AAAG)	N/A	HBB:c.199_202delAAAG	β	Causative	β-thalassaemia	NG_000007.3	70923
2188	CD 66 -A	N/A	HBB:c.201delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70925
175	CD 67 (-TG)	N/A	HBB:c.203_204delGT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70927
3019	CD 68-70 (-7bp): (-TCGGTGC)	N/A	HBB:c.206_212delTCGGTGC	β	Causative	β-thalassaemia	NG_000007.3	70930
2522	CD 69 GGT>G-T	N/A	HBB:c.209delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70933
2189	CD 69 -T	N/A	HBB:c.210delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70934
176	CD 71 (+T)	N/A	HBB:c.216dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70940
2462	CD 71 -T	N/A	HBB:c.216delT	β	Causative	β-thalassaemia	NG_000007.3	70940
177	CD 71/72 (+A)	N/A	HBB:c.217dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
178	CD 72-73 (-AGTGA, +T)	N/A	HBB: c.217_221delAGTGAinsT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
2181	CD 72/73 (+T)	N/A	HBB:c.219dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70943
1043	CD 73-75 (-GATGGCCTG; + Ala-Arg-Cys-Gln)	Hb Montreal	HBB:c.220_228delinsGCTCGGTGCCAG	β	Causative	β-chain variant	NG_000007.3	70944
1044	CD 74-76 (-GCCTGG)	Hb Saint-Antoine	HBB:c.224_229delGCCTGG	β	Causative	β-chain variant	NG_000007.3	70948
179	CD 75 (-C)	N/A	HBB:c.226delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70950
180	CD 76 GCT>--T (-GC)	N/A	HBB:c.229_230delGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70953
181	CD 76 (-C)	N/A	HBB:c.230delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70954
182	CD 78 CTG>-TG	N/A	HBB:c.235delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70959
3299	CD 77/78 (+C)	N/A	HBB:c.235dupC	β	Causative	β-thalassaemia	NG_000007.3	70959
3225	CD 78/85 (-20bp)	N/A	HBB:c.237_256delGGACAACCTCAAGGGCACCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70961
183	CD 80/81 (-C)	N/A	HBB:c.244delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
184	CD 81-87 (-22 bp)	N/A	HBB:c.244_265del22	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
185	CD 82/83 (-G)	N/A	HBB:c.251delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70975
186	CD 84-86 (-8 bp): (-CACCTTTG)	N/A	HBB:c.253_260del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70977
187	CD 84/85 (+C)	N/A	HBB:c.255dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70979
188	CD 84-86 (+T)	N/A	HBB:c.258dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70982
3722	CD 86 GCC>GC-	N/A	HBB:c.261delC	β	Causative	β-thalassaemia	NG_000007.3	70985
4044	CD 87-91 (-14 bp)	N/A	HBB:c.263_276del	β	Causative	β-thalassaemia	NG_000007.3	70987
3253	CD 88 CTG>--G (HBB:c.265_266delCT)	N/A	HBB:c.265_266del	β	Causative	β-thalassaemia	NG_000007.3	70989
189	CD 88 (+T)	N/A	HBB:c.266dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
190	CD 88 (-TG)	N/A	HBB:c.266_267del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
3287	CD 89-93 (-14bp): (-AGTGAGCTGCACTG)	N/A	HBB:c.268_281delAGTGAGCTGCACTG	β	Causative	β-thalassaemia	NG_000007.3	70992
191	CD 89/90 (AGTGAG>AGAG)	N/A	HBB:c.270_271del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70994
2965	CD 89-90 (-TGAG)	Hb Wilde	HBB:c.270_273delTGAG	β	Causative	β-chain variant	NG_000007.3	70994
3044	CD 90 GAG>-AG	N/A	HBB:c.271delG	β	Causative	β-thalassaemia	NG_000007.3	70995
1124	CD 95/96 (+15 bp)	Hb Koriyama	HBB:c.274_288dup	β	Causative	β-chain variant	NG_000007.3	70998
193	CD 91 CTG>C-G	Hb Morgantown	HBB:c.275del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
194	CD 91 (+T)	N/A	HBB:c.275dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
195	CD 93/94 (+TG)	Hb Agnana	HBB:c.282_283dupTG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71006
196	CD 95 (+A)	N/A	HBB:c.287dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71011
3888	CD 97/98 (+GCAC)	N/A	HBB:c.291_294dup	β	Causative	β-thalassaemia	NG_000007.3	71015
2966	CD 98/99 (+TG)	Hb Patagonia	HBB:c.296_297dup	β	Causative	β-chain variant	NG_000007.3	71020
198	CD 100 (-CC,+TCTGAGAACTT) >158aa	N/A	HBB:c.301_302delCCinsTCTGAGAACTT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71025
2279	CD 102 AAC>ATCAC	N/A	HBB:c.308insTC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71032
3636	CD 104 (-A)	N/A	HBB:c.313delA	β	Causative	β-thalassaemia	NG_000007.3	71037
3391	IVS II-648/649 (-T)	N/A	HBB:c.316-202del	β	Causative	β-thalassaemia	NG_000007.3	71688
231	CD 107 (+G)	N/A	HBB:c.323dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
233	CD 109 (-G) >156aa	Hb Manhattan	HBB:c.328delG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71902
4075	CD 111/112 (+C)	N/A	HBB:c.336dup	β	Causative	β-thalassaemia	NG_000007.3	71910
2192	CD 114/115 (+TGTGCTG)	N/A	HBB:c.339_345dupTGTGCTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
236	CD 113 (-G) >156aa	N/A	HBB:c.340delG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71914
238	CD 114 (-CT, +G) >156aa	Hb Geneva	HBB:c.343_344delinsG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71917
3308	CD 115-116 (-CC, +G) >156aa	Hb Grand Junction	HBB:c.348_349delinsG	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	71922
240	CD 116 (+TGAT)	N/A	HBB:c.349_350insTGAT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71924
2193	CD 117 -C	N/A	HBB:c.354delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71928
3846	CD 118 (-TT)	N/A	HBB:c.356_357delTT	β	Causative	β-thalassaemia	NG_000007.3	71930
241	CD 118 (-T) > 156aa	Hb Sainte Seve	HBB:c.357delT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71931
242	CD 120 -A [156 aa] (CD 120 AAA>AA-)	Hb Filottrano	HBB:c.363delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71937
243	CD 120/121 (+A)	N/A	HBB:c.363dupA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71937
245	CD 123 (-A) >156aa	Hb Makabe	HBB:c.370delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71944
246	CD 123-125 (-ACCCCACC) >135aa	Hb Khon Kaen	HBB:c.370_378delACCCCACCA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71944
3555	CD 124 (+C)	N/A	HBB:c.374dup	β	Causative	β-thalassaemia, Haemolytic anaemia	NG_000007.3	71948
4065	CD 124 (-C)	N/A	HBB:c.374delC	β	Causative	α-thalassaemia	NG_000007.3	71948
247	CD 124 (-A) >156aa	N/A	HBB:c.375delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
2194	CD 124/125 (+A)	N/A	HBB:c.375dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
3227	CD 125-126 (+CCAGT)	N/A	HBB:c.376_380dupCCAGT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71950
2195	CD 125-127 (-CAGTGC)	N/A	HBB:c.377_382delCAGTGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71951
249	CD 125 (-A) >156aa	N/A	HBB:c.378delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71952
3563	CD 126 GTG>-TG	N/A	HBB:c.379delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71953
250	CD 126 (-T) >156aa	Hb Vercelli	HBB:c.380delT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71954
252	CD 126-131 (-17 bp)	Hb Westdale	HBB:c.380_396delTGCAGGCTGCCTATCAG	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	71954
257	CD 128/129 (-4, +5, -11 bp) >153aa	N/A	HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71959
3951	CD 129-133 (-CCTATCAGAAAGT)	Hb Phoenix	HBB:c.389_401del	β	Causative	β-chain variant	NG_000007.3	71963
2197	CD 131 (+A)	N/A	HBB:c.395dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71969
259	CD 131/132 (+GCCT)	N/A	HBB:c.396_397insGCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
260	CD 131-132 (-GA) >138aa	N/A	HBB:c.396_397delGA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
261	CD 131-134 (-11bp) >134aa	N/A	HBB:c.396_406del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
3896	CD 132 (AAA>AA-)	N/A	HBB:c.399del	β	Causative	β-thalassaemia	NG_000007.3	71973
3249	CD 135 GCT>GC-	Hb Urumqi	HBB:c.408delT	β	Causative	β-chain variant, Haemolytic anaemia	NG_000007.3	71982
3361	CD 138/139 (+T)	N/A	HBB:c.417dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71991
2282	CD 139/140 +T [163 aa]	Hb Boston-Kuwait	HBB:c.420dupT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71994
265	CD 141 (-C) >156aa	Hb Florida	HBB:c.424delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71998
1290	CD 142 (-CC)	Hb Uzes	HBB:c.429_430delCC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72003
2024	CD 143 (-C)	Hb Montreal II	HBB:c.430delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72004
1320	CD 147 (+TA)	Hb Monplaisir	HBB:c.442_443dupTA	β	Causative	β-chain variant	NG_000007.3	72016
2076	CD 54-57 (-11bp): (-GAAGTCTGAGG)	N/A	NG_013087.1:g.6133_6143delGAAGTCTGAGG	KLF1	Modifier	Hb F levels	NG_013087.1	6133
4103	p.Gly176AlafsX179	N/A	NC_000019.10(NM_006563.5):c.525_526insGCGCCGG	KLF1	Modifier	N/A	NG_013087.1	6499
2085	CD 175/176 (+7bp): (+CGGCGCC) (c.519_525dupCGGCGCC, p.Gly176Argfs*179)	N/A	NG_013087.1:g.6493_6499dupCGGCGCC	KLF1	Modifier	Hb F levels, Anaemia	NG_013087.1	6500
2278	CD 302 (+4bp): (+GCGC)	N/A	NG_013087.1:g.6877_6878insGCGC	KLF1	Modifier	Hb F levels	NG_013087.1	6877
3486	CD 314 GAA>GA- (c.942delA)	N/A	NG_013087.1:g.7172delA	KLF1	Modifier	Hb F levels	NG_013087.1	7172
2296	CD 319 (+1bp): (+G)	N/A	NG_013087.1:g.7184dupG	KLF1	Modifier	N/A	NG_013087.1	7184
2517	CD 328 CGC>-GC	N/A	NG_013087.1:g.7212delC	KLF1	Modifier	Anaemia	NG_013087.1	7212
3979	PUM1:p.H1090Pfs*16	N/A	NC_000001.11:g.30936810_30936813del, NM_001020658.2(PUM1):c.3267_3270del	PUM1	Modifier	Hb F levels	N/A

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.