Loading... Please wait!
Quick filtering
Showing all entries with the following effect: frameshift (Show All):
Effect on Funtion:'Frameshift'
Effect on Funtion:'Frameshift'
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
4071 | CD 1 (-G) | N/A | HBA2:c.4del | α2 | Causative | α-thalassaemia | NG_000006.1 | 33779 |
3720 | CD 1/2 (+TG) | N/A | HBA2:c.6_7insTG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33781 |
2206 | CD 8 (-C) | N/A | HBA2:c.27delC | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33802 |
3714 | CD 15/16 (+T) | N/A | HBA2:c.48_49insT | α2 | Causative | α-thalassaemia | NG_000006.1 | 33823 |
3885 | CD 17 (-C) (Hb Kunming) | N/A | HBA2:c.54delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 33829 |
350 | CD 18 GGC>G-C | N/A | HBA2:c.56delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33831 |
2465 | CD 19 GCG>GC- | N/A | HBA2:c.60delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33835 |
2207 | CD 21/22 +T | N/A | HBA2:c.66dupT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33841 |
353 | CD 22 -C | N/A | HBA2:c.69delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
3568 | CD 28 GCC>-CC | N/A | HBA2:c.85delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33860 |
3745 | IVS I-1 G>A | N/A | HBA2:c.95+1G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33871 |
2211 | CD 37 CCC>CC- | N/A | HBA2:c.114delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34006 |
372 | CD 39-41 (-9 bp, + 8 bp) | N/A | NG_000006.1:g.34010_34018delinsTACTTCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34010 |
2493 | CD 40 AAG>AA- | N/A | HBA2:c.123delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34015 |
2214 | CD 43 TTC>T-C | N/A | HBA2:c.131delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34023 |
2215 | CD 43/44 -C | N/A | HBA2:c.132delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34024 |
3405 | CD 47-53 (-20bp): (-GACCTGAGCCACGGCTCTGC) | N/A | HBA2:c.142_161del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34034 |
2216 | CD 47 -A | N/A | HBA2:c.143delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34035 |
3053 | CD 47/48 (-4bp): (-ACCT) | N/A | HBA2:c.143_146delACCT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34035 |
374 | CD 49 -GC | N/A | HBA2:c.149_150delGC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34041 |
2217 | CD 51/52 +G | N/A | HBA2:c.156_157insG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34048 |
3079 | CD 55 +T | N/A | HBA2:c.168dup | α2 | Causative | α-thalassaemia | NG_000006.1 | 34060 |
3054 | CD 56 AAG>--G | N/A | HBA2:c.169_170delAA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34061 |
2576 | CD 68 AAC>A-C | N/A | HBA2:c.206delA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34098 |
4070 | CD 68 (-C) | N/A | HBA2:c.207del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34099 |
3705 | CD 72 (+C) | N/A | HBA2:c.217dup | α2 | Causative | α-thalassaemia | NG_000006.1 | 34109 |
3055 | CD 73/74 (-4bp): (-GTGG) | N/A | HBA2:c.220_223delGTGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34112 |
3632 | CD 76/77 (+T) | N/A | HBB:c.231_232insT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34123 |
3974 | CD 82-83 (-CCTG) | N/A | HBA2:c.249_252del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34141 |
644 | CD 87 +9 bp [+Ser-Asp-Leu] | Hb Neuilly-sur-Marne | HBA1:c.253_261dup | HBA2:c.253_261dup | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34154, 37949 |
3569 | CD 89-93 (-13bp): (-CACAAGCTTCGGG) | N/A | HBA2:c.268_280delCACAAGCTTCGGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34160 |
3572 | CD 90‐92 (-8bp): (‐AGCTTCGG) | N/A | HBA2:c.272_279delAGCTTCGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34164 |
4137 | CD 98 TTC>TT- | N/A | HBA2:c.297del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34189 |
2436 | CD 107 GTG>G-G | Hb Lynwood | HBA2:c.323delT | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34357 |
398 | CD 109 (-C) | Hb Sciacca | HBA1:c.328delC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34362 |
721 | CD 116-117 +15 bp [+His-Leu-Pro-Ala-Glu] | Hb Zaïre | HBA1:c.337_351dup | HBA2:c.337_351dup | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34371, 38182 |
4068 | CD 112 CAC>-AC | N/A | HBA2:c.337delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34371 |
402 | CD 112/113 -C | N/A | HBA2:c.339delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34373 |
404 | CD 113-116 (-12 bp) & CD 112 (C>G) | Hb Leida | HBA2:c.[339C>G;340_351delCTCCCCGCCGAG] | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34373 |
2527 | CD 114 (+CC) | N/A | HBA2:c.344_345dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34378 |
3140 | CD 114 CCC>CC- | N/A | HBA2:c.345delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34379 |
2221 | CD 115 -GAGTTCACCCC [166 aa] | N/A | HBA2:c.349_359delGAGTTCACCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
3862 | CD 125 (+C) | N/A | HBA2:c.376dupC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34410 |
3305 | CD 126 GCG>-CG | N/A | HBA2:c.379delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34413 |
2480 | CD 129 CTG>-TG | Hb Hamilton Hill | HBA2:c.388delC | α2 | Causative | α-chain variant | NG_000006.1 | 34422 |
4085 | CD 132 (+T) | Hb Balkh | HBA2:c.398dup | α2 | Causative | α-chain variant | NG_000006.1 | 34432 |
3404 | CD 133-135 (-AGCACCG) | Hb Aalesund | HBA2:c.400_406del | α2 | Causative | α-chain variant | NG_000006.1 | 34434 |
775 | CD 139 (-A) | Hb Wayne | HBA2:c.420delA | α2 | Causative | α-chain variant | NG_000006.1 | 34454 |
4006 | CD 7 AAG>A-G (g.188 (GenBank MK600512.1)) | N/A | HBA1:c.23delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37602 |
2205 | CD 20 +T | N/A | HBA1:c.62_63insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37641 |
4077 | CD 37 CCC>CC- | N/A | HBA1:c.114del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37810 |
3403 | CD 39 +A | N/A | HBA2:c.118_119insA | α2 | Causative | α-thalassaemia | NG_000006.1 | 37814 |
2468 | CD 44 +C | N/A | HBA1:c.134_135insC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37830 |
375 | CD 51-55 (-13 bp deletion) | N/A | HBA1:c.155_167delGCTCTGCCCAGGT | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37851 |
3717 | CD 61 AAG>-AG | N/A | HBA1:c.184del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37880 |
382 | CD 62 GTG>-TG | Hb Champaign | HBA1:c.187delG | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
2347 | CD 62 -G | N/A | HBA1:c.189delG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37885 |
3373 | CD 67 ACC>-CC | N/A | HBA1:c.202delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37898 |
3326 | CD 73 GTG>G-G | N/A | HBA1:c.221delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37917 |
386 | CD 78 -C | N/A | HBA1:c.237delC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37933 |
2219 | CD 81 -T | N/A | HBA2:c.244delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37940 |
3861 | CD 87 (-A) | N/A | HBA1:c.263delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37959 |
4093 | CD 95 (-C) | Hb Campania | HBA1:c.287delC | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37983 |
2224 | CD 110-114 (-13 bp) | N/A | HBA1:c.333_345delCGCCCACCTCCCC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38178 |
723 | CD 118-119 +9 bp [+Glu-Phe-Thr] (Hb Dakar) | Hb Grady | HBA1:c.349_357dup | α1 | Causative | α-chain variant | NG_000006.1 | 38194 |
3281 | CD 130 (+T) | Hb Sichuan | HBA1:c.393_394insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38238 |
416 | CD 131 (+T) >175aa | Hb Pak Num Po | HBA1:c.396dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38241 |
753 | CD 131 TCT>TC- | Hb Fez | HBA1:c.396delT | α1 | Causative | α-chain variant | NG_000006.1 | 38241 |
4084 | CD 133-135 (-7 bp, -GCACCGT) | N/A | HBA1:c.401_407del | α1 | Causative | α-thalassaemia | NG_000006.1 | 38246 |
760 | CD 134 -C | Hb Senlis | HBA1:c.404delC | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38249 |
3483 | CD 121 GAA>-AA | Hb Mahasarakham | HBB:c.364delG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 6394 |
3232 | CD 10 GCT>-CT | N/A | HBD:c.31delG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63213 |
3806 | CD 44-48 (-CTTTGGGGATC) (p.Phe46Valfs*4) | N/A | HBD:c.135_145del | δ | Causative | δ-thalassaemia | NG_000007.3 | 63445 |
2575 | CD 58 +C | N/A | HBD:c.176_177insC | δ | Causative | δ-thalassaemia | NG_000007.3 | 63486 |
3441 | CD 59 AAG>A-G (δ0 59 (-A)) | N/A | HBD:c.179delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63489 |
3237 | CD 59/60 (+GG) | N/A | HBD:c.180_181dup | δ | Causative | δ-thalassaemia | NG_000007.3 | 63490 |
3236 | CD 87 CAG>C-G | N/A | HBD:c.263delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63573 |
3975 | CD 98 (-GTG, +A) | N/A | HBD:c.295_297delGTGinsA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63605 |
2521 | CD 110-111 +GT | N/A | HBD:c.333_334insGT | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64541 |
3234 | CD 113 (+TG) | N/A | HBD:c.341_342dupTG | δ | Causative | δ-thalassaemia | NG_000007.3 | 64549 |
4150 | CD 122/123 (+A) | N/A | HBD:c.369_370insA | δ | Causative | δ-thalassaemia | NG_000007.3 | 64577 |
3546 | CD 130 TAT>-AT | Hb A2-Gaslini 1 | HBD:c.391delT | δ | Causative | δ-chain variant | NG_000007.3 | 64599 |
3752 | -99 to -85 (-15bp) | N/A | HBB:c.-149_-135delGTGGAGCCACACCCT | β | Causative | β-thalassaemia | NG_000007.3 | 70446 |
50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3437 | CD 2 CAT>-AT | Hb Bundelkhand | HBB:c.7delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3014 | CD 2 CAT>C-T | N/A | HBB:c.8delA | β | Causative | β-thalassaemia | NG_000007.3 | 70602 |
3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
3817 | CD 4 (-T) | N/A | HBB:c.14delC | β | Causative | β-thalassaemia | NG_000007.3 | 70608 |
54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
58 | CD 6 (-G) | N/A | HBB:c.19delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
59 | CD 6-10 (-13 bp) | N/A | HBB:c.21_33delGGAGAAGTCTGCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70615 |
3288 | CD7 GAG>G-G | N/A | HBB:c.23delA | β | Causative | β-thalassaemia | NG_000007.3 | 70617 |
2958 | CD 7/8 (+G) | N/A | HBB:c.24dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70618 |
61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
64 | CD 9/10 (+T) | Hb Gaziantep | HBB:c.30dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70624 |
3399 | CD 9 TCT>TC- | Hb Antep | HBB:c.30delT | β | Causative | β-chain variant | NG_000007.3 | 70624 |
4108 | CD 10 GCC>GTC [Ala>Val] | N/A | HBB:c.31_32insT | β | Causative | β-thalassaemia | NG_000007.3 | 70625 |
66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
3721 | CD 14 CTG>-TG | N/A | HBB:c.43delC | β | Causative | β-thalassaemia | NG_000007.3 | 70637 |
68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
3609 | CD 20/21 (-TGGA) | N/A | HBB:c.62_65delTGGA | β | Causative | β-thalassaemia | NG_000007.3 | 70656 |
80 | CD 20-22 (GTGGATGAA>GTGAA) | N/A | HBB:c.64_67del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
872 | CD 22-26 (-12bp) | Hb Olinda | HBB:c.69_80delAGTTGGTGGTGA | β | Causative | β-chain variant | NG_000007.3 | 70663 |
878 | CD 23/24 (GTTGGT>GGT) | Hb Freiburg | HBB:c.71_73del | β | Causative | β-chain variant | NG_000007.3 | 70665 |
85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
2174 | CD 24 -G | N/A | HBB:c.74delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | NC_000011.10(NM_000518.4):c.93-22_95del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
128 | CD 36 CCT>C-T (CD 36 (-C)) | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
136 | CD 37 (-G) | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
147 | CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT)) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
2954 | CD 42 TTT>TT- | Hb Yala | HBB:c.129delT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70853 |
149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
150 | CD 43 (GAG>TAG) | N/A | HBB:c.130G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
3594 | CD 43 (GAG>TAG);CD 71/72 (+A) | N/A | HBB:c.[130G>T;217dupA] | β | Causative | β-thalassaemia | NG_000007.3 | 70854, 70941 |
946 | CD 43-46 (-9bp) | Hb Niteroi | HBB:c.131_139del | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70855 |
151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
154 | CD 45/46 (+A) | N/A | HBB:c.138_139insA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
2960 | CD 46/47 (+G) | N/A | HBB:c.142_142dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70866 |
155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
2407 | CD 49-55 (-19 bp +4 bp) | Hb Martinez | HBB:c.149_167delinsAGCT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70873 |
157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
2959 | CD 52 GAT>G-T | N/A | HBB:c.158delA | β | Causative | β-thalassaemia | NG_000007.3 | 70882 |
160 | CD 53 (-T) | N/A | HBB:c.162delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70886 |
161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
4094 | CD 54 GTT>-TT | N/A | HBB:c.163del | β | Causative | β-thalassaemia | NG_000007.3 | 70887 |
162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
164 | CD 54-58 (-13bp) | N/A | HBB:c.165_177delTATGGGCAACCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
2990 | CD 55-59 (-13 bp) | N/A | HBB:c.167_179del | β | Causative | β-thalassaemia | NG_000007.3 | 70891 |
166 | CD 56-60 (+14 bp) | N/A | HBB:c.170_183dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
989 | CD 56-60 (-12bp) | Hb Tochigi | HBB:c.170_181del | β | Causative | β-chain variant | NG_000007.3 | 70894 |
167 | CD 58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
3311 | CD 58 CCT>C-T | N/A | HBB:c.176delC | β | Causative | β-thalassaemia | NG_000007.3 | 70900 |
3061 | CD 59 (+T) | N/A | HBB:c.178_179insT | β | Causative | β-thalassaemia | NG_000007.3 | 70902 |
168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
4086 | CD 59 AAG>AA-, CD 59 (-G) | N/A | HBB:c.180del | β | Causative | β-thalassaemia | NG_000007.3 | 70904 |
171 | CD 62-64 (-7bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
3944 | CD 64 (+G) | N/A | HBB:c.194dup | β | Causative | β-thalassaemia | NG_000007.3 | 70918 |
3854 | CD 66/67 (-AAAG) | N/A | HBB:c.199_202delAAAG | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
3019 | CD 68-70 (-7bp): (-TCGGTGC) | N/A | HBB:c.206_212delTCGGTGC | β | Causative | β-thalassaemia | NG_000007.3 | 70930 |
2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
2462 | CD 71 -T | N/A | HBB:c.216delT | β | Causative | β-thalassaemia | NG_000007.3 | 70940 |
177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
1043 | CD 73-75 (-GATGGCCTG; + Ala-Arg-Cys-Gln) | Hb Montreal | HBB:c.220_228delinsGCTCGGTGCCAG | β | Causative | β-chain variant | NG_000007.3 | 70944 |
1044 | CD 74-76 (-GCCTGG) | Hb Saint-Antoine | HBB:c.224_229delGCCTGG | β | Causative | β-chain variant | NG_000007.3 | 70948 |
179 | CD 75 (-C) | N/A | HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70950 |
180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
182 | CD 78 CTG>-TG | N/A | HBB:c.235delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70959 |
3299 | CD 77/78 (+C) | N/A | HBB:c.235dupC | β | Causative | β-thalassaemia | NG_000007.3 | 70959 |
3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
4125 | CD 85 (-T) | N/A | HBB:c.258del | β | Causative | β-thalassaemia, Anaemia | NG_000007.3 | 70982 |
3722 | CD 86 GCC>GC- | N/A | HBB:c.261delC | β | Causative | β-thalassaemia | NG_000007.3 | 70985 |
4044 | CD 87-91 (-14 bp) | N/A | HBB:c.263_276del | β | Causative | β-thalassaemia | NG_000007.3 | 70987 |
3253 | CD 88 CTG>--G (HBB:c.265_266delCT) | N/A | HBB:c.265_266del | β | Causative | β-thalassaemia | NG_000007.3 | 70989 |
189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
3287 | CD 89-93 (-14bp): (-AGTGAGCTGCACTG) | N/A | HBB:c.268_281delAGTGAGCTGCACTG | β | Causative | β-thalassaemia | NG_000007.3 | 70992 |
191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
2965 | CD 89-90 (-TGAG) | Hb Wilde | HBB:c.270_273delTGAG | β | Causative | β-chain variant | NG_000007.3 | 70994 |
3044 | CD 90 GAG>-AG | N/A | HBB:c.271delG | β | Causative | β-thalassaemia | NG_000007.3 | 70995 |
1124 | CD 95/96 (+15 bp) | Hb Koriyama | HBB:c.274_288dup | β | Causative | β-chain variant | NG_000007.3 | 70998 |
193 | CD 91 CTG>C-G | Hb Morgantown | HBB:c.275del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
195 | CD 93/94 (+TG) | Hb Agnana | HBB:c.282_283dupTG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71006 |
196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
3888 | CD 97/98 (+GCAC) | N/A | HBB:c.291_294dup | β | Causative | β-thalassaemia | NG_000007.3 | 71015 |
2966 | CD 98/99 (+TG) | Hb Patagonia | HBB:c.296_297dup | β | Causative | β-chain variant | NG_000007.3 | 71020 |
198 | CD 100 (-CC,+TCTGAGAACTT) >158aa | N/A | HBB:c.301_302delCCinsTCTGAGAACTT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71025 |
2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
3636 | CD 104 (-A) | N/A | HBB:c.313delA | β | Causative | β-thalassaemia | NG_000007.3 | 71037 |
3391 | IVS II-648/649 (-T) | N/A | HBB:c.316-202del | β | Causative | β-thalassaemia | NG_000007.3 | 71688 |
231 | CD 107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
233 | CD 109 (-G) >156aa | Hb Manhattan | HBB:c.328delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71902 |
4075 | CD 111/112 (+C) | N/A | HBB:c.336dup | β | Causative | β-thalassaemia | NG_000007.3 | 71910 |
2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
236 | CD 113 (-G) >156aa | N/A | HBB:c.340delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71914 |
238 | CD 114 (-CT, +G) >156aa | Hb Geneva | HBB:c.343_344delinsG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71917 |
3308 | CD 115-116 (-CC, +G) >156aa | Hb Grand Junction | HBB:c.348_349delinsG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71922 |
240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
2193 | CD 117 -C | N/A | HBB:c.354delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71928 |
3846 | CD 118 (-TT) | N/A | HBB:c.356_357delTT | β | Causative | β-thalassaemia | NG_000007.3 | 71930 |
241 | CD 118 (-T) > 156aa | Hb Sainte Seve | HBB:c.357delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71931 |
242 | CD 120 -A [156 aa] (CD 120 AAA>AA-) | Hb Filottrano | HBB:c.363delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
243 | CD 120/121 (+A) | N/A | HBB:c.363dupA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
245 | CD 123 (-A) >156aa | Hb Makabe | HBB:c.370delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
246 | CD 123-125 (-ACCCCACC) >135aa | Hb Khon Kaen | HBB:c.370_378delACCCCACCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
4065 | CD 124 (-C) | N/A | HBB:c.374delC | β | Causative | α-thalassaemia | NG_000007.3 | 71948 |
247 | CD 124 (-A) >156aa | N/A | HBB:c.375delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
4155 | CD 124/125 (-AC) | N/A | HBB:c.375_376delAC | β | Causative | β-thalassaemia | NG_000007.3 | 71949 |
3227 | CD 125-126 (+CCAGT) | N/A | HBB:c.376_380dupCCAGT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
2195 | CD 125-127 (-CAGTGC) | N/A | HBB:c.377_382delCAGTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71951 |
249 | CD 125 (-A) >156aa | N/A | HBB:c.378delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71952 |
3563 | CD 126 GTG>-TG | N/A | HBB:c.379delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71953 |
250 | CD 126 (-T) >156aa | Hb Vercelli | HBB:c.380delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
252 | CD 126-131 (-17 bp) | Hb Westdale | HBB:c.380_396delTGCAGGCTGCCTATCAG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71954 |
257 | CD 128/129 (-4, +5, -11 bp) >153aa | N/A | HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
3951 | CD 129-133 (-CCTATCAGAAAGT) | Hb Phoenix | HBB:c.389_401del | β | Causative | β-chain variant | NG_000007.3 | 71963 |
2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
259 | CD 131/132 (+GCCT) | N/A | HBB:c.396_397insGCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
260 | CD 131-132 (-GA) >138aa | N/A | HBB:c.396_397delGA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
261 | CD 131-134 (-11bp) >134aa | N/A | HBB:c.396_406del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
3896 | CD 132 (AAA>AA-) | N/A | HBB:c.399del | β | Causative | β-thalassaemia | NG_000007.3 | 71973 |
3249 | CD 135 GCT>GC- | Hb Urumqi | HBB:c.408delT | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71982 |
3361 | CD 138/139 (+T) | N/A | HBB:c.417dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71991 |
2282 | CD 139/140 +T [163 aa] | Hb Boston-Kuwait | HBB:c.420dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71994 |
265 | CD 141 (-C) >156aa | Hb Florida | HBB:c.424delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71998 |
1290 | CD 142 (-CC) | Hb Uzes | HBB:c.429_430delCC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72003 |
2024 | CD 143 (-C) | Hb Montreal II | HBB:c.430delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72004 |
1320 | CD 147 (+TA) | Hb Monplaisir | HBB:c.442_443dupTA | β | Causative | β-chain variant | NG_000007.3 | 72016 |
2076 | CD 54-57 (-11bp): (-GAAGTCTGAGG) | N/A | NG_013087.1:g.6133_6143delGAAGTCTGAGG | KLF1 | Modifier | Hb F levels | NG_013087.1 | 6133 |
4103 | p.Gly176AlafsX179 | N/A | NC_000019.10(NM_006563.5):c.525_526insGCGCCGG | KLF1 | Modifier | N/A | NG_013087.1 | 6499 |
2085 | CD 175/176 (+7bp): (+CGGCGCC) (c.519_525dupCGGCGCC, p.Gly176Argfs*179) | N/A | NG_013087.1:g.6493_6499dupCGGCGCC | KLF1 | Modifier | Hb F levels, Anaemia | NG_013087.1 | 6500 |
2278 | CD 302 (+4bp): (+GCGC) | N/A | NG_013087.1:g.6877_6878insGCGC | KLF1 | Modifier | Hb F levels | NG_013087.1 | 6877 |
3486 | CD 314 GAA>GA- (c.942delA) | N/A | NG_013087.1:g.7172delA | KLF1 | Modifier | Hb F levels | NG_013087.1 | 7172 |
2296 | CD 319 (+1bp): (+G) | N/A | NG_013087.1:g.7184dupG | KLF1 | Modifier | N/A | NG_013087.1 | 7184 |
2517 | CD 328 CGC>-GC | N/A | NG_013087.1:g.7212delC | KLF1 | Modifier | Anaemia | NG_013087.1 | 7212 |
3979 | PUM1:p.H1090Pfs*16 | N/A | NC_000001.11:g.30936810_30936813del, NM_001020658.2(PUM1):c.3267_3270del | PUM1 | Modifier | Hb F levels | N/A |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2025-09-15 11:21:02