IthaGenes

Loading... Please wait!

Quick filtering

Showing all entries with clinican phenotype Ineffective erythropoiesis (Show All):

IthaID	Common Name	Hb Name	HGVS Name	Genes	Functionality	Phenotype	Locus	Position
2548	Inv-Del English V	N/A	NC_000011.10:g.5194460_5253454invdel5194460_5194542del5253454_5375965	βLCR, ε, Aγ, Gγ, δ, β, pseudo β	Causative	εγδβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3
3393	3.5 kb deletion (Thai, 3485 bp deletion)	N/A	NC_000011.10:g.5224302_5227791del3490bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3
291	Czech (4237 bp deletion)	N/A	NG_000007.3:g.67258_71501del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
293	Cape Verdean	N/A	NG_000007.3:g.71548_79271del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
294	Asian Indian (10329 bp deletion)	N/A	NG_000007.3:g.(67531_67533)_(77874_77876)del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
295	Australian (Anglo Saxon) (12023 bp deletion)	N/A	NC_000011.10:g.5215894_5227926del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
299	Italian (~67 kb deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
2123	7719 bp deletion	N/A	NG_000007.3:g.71550_79270del7719	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
3792	N/A	Hb Lepore-Hong Kong	NG_000007.3:g.63154_70565del	δ, β	Causative	δβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	63154
298	Filipino (~45 kb deletion)	N/A	NC_000011.10:g.5112882 _5231358del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66258
292	Turk (~7.6 kb deletion)	N/A	NG_000007.3:g.[52524_60162del;66278_73952del]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66278
2283	South-Italy	N/A	NC_000011.10:g.5164564_5230714del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66902
2157	Indian (4056 bp deletion)	N/A	NG_000007.3:g.67357_71413del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	67357
296	Dutch (12620 bp deletion)	N/A	NG_000007.3:g.68071_80682del12612	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	68071
289	Croatian (1605 bp deletion)	N/A	NG_000007.3:g.69561_71164del1604	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	69561
290	Thai (3485 bp deletion, Chongqing deletion, NC_000011.10: g.5224303-5227790del, NC_000011.9: g.5245533_5249020del)	N/A	NG_000007.3:g.69826_73313del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	69826
2150	1357 bp deletion (Taiwanese deletion)	N/A	NG_000007.3:g.69997_71353del1357	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	69997
288	Black, British (1393 bp deletion)	N/A	NG_000007.3:g.70060_71452del1393	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70060
2125	Afghan (909 bp deletion)	N/A	NG_000007:g.70067_70976del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70067
284	468 bp deletion	N/A	NG_000007.3:g.70070_70537del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70070
285	Black (532 bp deletion)	N/A	HBB:c.-504_28del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70091
1	-190 (G>A)	N/A	HBB:c.-240G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70355
2122	125 bp deletion	N/A	NG_000007.3:g.70360_70485del125	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70360
2153	Kabylia deletion/insertion	N/A	NG_000007.3:g.70417_72458delinsATAAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70417
283	290 bp deletion	N/A	HBB:c.-176_92+25del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70419
2	-102 (C>A)	N/A	HBB:c.-152C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70443
3	-101 (C>T)	N/A	HBB:c.-151C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70444
4	-101 (C>G)	N/A	HBB:c.-151C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70444
5	-93 C>G	N/A	HBB:c.-143C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70452
6	-92 (C>T)	N/A	HBB:c.-142C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70453
7	-90 (C>T)	N/A	HBB:c.-140C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70455
3224	-90 (C>G)	N/A	HBB:c.-140C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70455
8	-88 (C>T)	N/A	HBB:c.-138C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70457
9	-88 (C>A)	N/A	HBB:c.-138C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70457
2178	-88 C>G	N/A	HBB:c.-138C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70457
10	-87 C>G	N/A	HBB:c.-137C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70458
11	-87 (C>T)	N/A	HBB:c.-137C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70458
12	-87 (C>A)	N/A	HBB:c.-137C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70458
13	-86 C>G	N/A	HBB:c.-136C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70459
14	-86 (C>A)	N/A	HBB:c.-136C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70459
15	-73 (A>T)	N/A	HBB:c.-123A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70472
2997	-72 T>A	N/A	HBB:c.-122T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70473
2171	-71 C>T	N/A	HBB:c.-121C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70474
16	-56 G>C	N/A	HBB:c.-106G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70489
17	-50 G>A	N/A	HBB:c.-100G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70495
2172	-41 A>T	N/A	HBB:c.-91A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70504
18	-32 (C>A)	N/A	HBB:c.-82C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70513
19	-32 (C>T)	N/A	HBB:c.-82C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70513
20	-31 (A>G)	N/A	HBB:c.-81A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70514
21	-31 (A>C)	N/A	HBB:c.-81A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70514
22	-30 (T>A)	N/A	HBB:c.-80T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70515
23	-30 (T>C)	N/A	HBB:c.-80T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70515
2179	-30 T>G	N/A	HBB:c.-80T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70515
24	-29 to -26 (-AA)	N/A	HBB:c.-79_78delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70516
25	-29 (A>G)	N/A	HBB:c.-79A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70516
26	-29 (A>C)	N/A	HBB:c.-79A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70516
28	-28 (A>C)	N/A	HBB:c.-78A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70517
29	-28 (A>G)	N/A	HBB:c.-78A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70517
30	-27 (A>T)	N/A	HBB:c.-77A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70518
31	-27 (-AA)	N/A	HBB:c.-77_-76delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70518
2175	-26 A>C	N/A	HBB:c.-76A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70519
32	-25 (G>C)	N/A	HBB:c.-75G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70520
282	105 bp deletion	N/A	HBB:c.-74_31del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70521
34	CAP +1 (A>C)	N/A	HBB:c.-50A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70545
35	CAP +8 (C>T)	N/A	HBB:c.-43C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70552
36	CAP +10 (-T) (5'UTR +10 (-T))	N/A	HBB:c.-41delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70554
38	CAP +22 (G>A)	N/A	HBB:c.-29G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70566
3345	CAP +22 (G>T)	N/A	HBB:c.-29G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70566
33	-22 to +23 (+45 bp duplication)	N/A	NG_000007.3:g.70573_70617dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70573
39	CAP +33 (C>G)	N/A	HBB:c.-18C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70577
2176	CAP +39 C>T	N/A	HBB:c.-12C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70583
41	CAP +45 (G>C)	Hb Odisha	HBB:c.-6G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70589
42	Init CD ATG>GTG	N/A	HBB:c.1A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70595
43	Init CD ATG>CTG	N/A	HBB:c.1A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70595
44	Init CD ATG>ACG	N/A	HBB:c.2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
45	Init CD ATG>AGG	N/A	HBB:c.2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
46	Init CD ATG>AAG	N/A	HBB:c.2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
47	Init CD ATG>ATC	N/A	HBB:c.3G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
48	Init CD ATG>ATA	N/A	HBB:c.3G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
49	Init CD ATG>ATT	N/A	HBB:c.3G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
50	CD 1 (-G)	N/A	HBB:c.4delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70598
51	CD 2-4 (-9 bp, +31 bp)	N/A	HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
3437	CD 2 CAT>-AT	Hb Bundelkhand	HBB:c.7delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
53	CD 2/3 (+T); CD 5 (-C)	Hb Antalya	HBB:c.[9dupT; 17delC]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70603, 70611
3561	CD 2 CAT/CA-	N/A	HBB:c.9delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70603
52	CD 3 (+T)	N/A	HBB:c.11dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70605
55	CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG)	N/A	HBB:c.[15T>A;16C>T;19G>T]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70609, 70610, 70613
54	CD 5 -CT	N/A	HBB:c.17_18delCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70611
2180	CD 5/6 -TG	N/A	HBB:c.18_19delTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70612
56	CD 6 (GAG>TAG)	N/A	HBB:c.19G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
2184	CD 6-14 (-26 bp) (26 bp deletion)	N/A	HBB:c.20_45del26bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
57	CD 6 -A	N/A	HBB:c.20delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
58	CD 6 (-G)	N/A	HBB:c.20delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
59	CD 6-10 (-13 bp)	N/A	HBB:c.21_33delGGAGAAGTCTGCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70615
60	CD 7 GAG>TAG	N/A	HBB:c.22G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70616
61	CD 8 (-AA)	N/A	HBB:c.25_26delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70619
2185	CD 8/9 +AGAA	N/A	HBB:c.27_28insAGAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70620
62	CD 8/9 (+G)	N/A	HBB:c.27dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
3513	CD 8 AAG>AA-	N/A	HBB:c.27delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
63	CD 9 (+TA)	N/A	HBB:c.28_29insTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70622
64	CD 9/10 (+T)	Hb Gaziantep	HBB:c.30dupT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70624
65	CD 10 GCC>GCA [Ala>Ala]	N/A	HBB:c.33C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70627
66	CD 10 (-C)	N/A	HBB:c.33delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70627
67	CD 11 (-T)	N/A	HBB:c.36delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70630
68	CD 14 (+T)	N/A	HBB:c.44dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
2553	CD 14 CTG>C-G	N/A	HBB:c.44delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
69	CD 14/15 (+G)	N/A	HBB:c.45dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70639
70	CD 15 (-T)	N/A	HBB:c.46delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70640
72	CD 15 TGG>TAG	N/A	HBB:c.47G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70641
73	CD 15 TGG>TGA	N/A	HBB:c.48G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70642
71	CD 15/16 (+G)	N/A	HBB:c.50dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
74	CD 15/16 (-G)	N/A	HBB:c.50delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
75	CD 16 GGC>GG-	N/A	HBB:c.51delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70645
76	CD 16 GGC>GGT [Gly>Gly]	N/A	HBB:c.51C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70645
77	CD 17 AAG>TAG [Lys>STOP]	N/A	HBB:c.52A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70646
78	CD 17 (+A)	N/A	HBB:c.53dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70647
80	CD 20-22 (GTGGATGAA>GTGAA)	N/A	HBB:c.64_67del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
81	CD 20/21 (+G)	N/A	HBB:c.64dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
83	CD 22 (GAA>TAA)	N/A	HBB:c.67G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70661
84	CD 22-24 ( -7 bp): (-AAGTTGG)	N/A	HBB:c.68_74delAAGTTGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70662
85	CD 24 (-G, +CAC)	N/A	HBB:c.74delinsCAC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
2174	CD 24 -G	N/A	HBB:c.74delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
86	CD 24 GGT>GGA [Gly>Gly]	N/A	HBB:c.75T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70669
281	IVS I [3 end] -44 bp (44 bp deletion)	N/A	HBB:c.76_92+27del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70670
87	CD 25/26 (+T)	N/A	HBB:c.78dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70672
88	CD 26 GAG>AAG [Glu>Lys]	HbE	HBB:c.79G>A	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
89	CD 26 (GAG>TAG)	N/A	HBB:c.79G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
90	CD 26 (+T)	N/A	HBB:c.79_80insT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
91	CD 27 GCC>TCC [Ala>Ser]	Hb Knossos	HBB:c.82G>T	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70676
92	CD 27/28 (+C)	N/A	HBB:c.85dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
93	CD 28 (-C)	N/A	HBB:c.85delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
94	CD 28 CTG>CGG [Leu >Arg]	Hb Chesterfield	HBB:c.86T>G	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70680
95	CD 28/29 (-G)	N/A	HBB:c.89delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70683
96	CD 29 (C>T) or IVS I (-3) GGC>GGT (Gly>Gly)	N/A	HBB:c.90C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70684
97	CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly)	N/A	HBB:c.91A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
98	CD 30 (A>C) or IVS I (-2) AGG>CGG [Arg>Arg]	N/A	HBB:c.91A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
3484	CD 30 (-A) or IVS I (-2) AGG>-GG	N/A	HBB:c.91delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
99	CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys)	N/A	HBB:c.92G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70686
100	CD 30 (G>C) or IVS I (-1) AGG>ACG (Arg>Thr) (Hb Kairouan)	Hb Monroe	HBB:c.92G>C	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70686
101	IVS I-1 G>A	N/A	HBB:c.92+1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
102	IVS I-1 (G>T)	N/A	HBB:c.92+1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
103	IVS I-1 (G>C)	N/A	HBB:c.92+1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
104	IVS I-2 (T>G)	N/A	HBB:c.92+2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
105	IVS I-2 (T>C)	N/A	HBB:c.92+2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
106	IVS I-2 (T>A)	N/A	HBB:c.92+2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
107	IVS I-5 (G>C)	N/A	HBB:c.92+5G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70691
108	IVS I-5 (G>T)	N/A	HBB:c.92+5G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70691
109	IVS I-5 (G>A)	N/A	HBB:c.92+5G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70691
111	IVS I-6 (T>C)	N/A	HBB:c.92+6T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70692
3565	IVS I-6 (T>G)	N/A	HBB:c.92+6T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70692
112	IVS I-7 A>T	N/A	HBB:c.92+7A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70693
3276	IVS I-7 A>G	N/A	HBB:c.92+7A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70693
280	IVS I [3' end] (-25 bp) (25 bp deletion)	N/A	NC_000011.10(NM_000518.4):c.93-22_95del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70795
2173	IVS I-109 (-T)	N/A	HBB:c.93-22delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70795
113	IVS I-110 G>A	N/A	HBB:c.93-21G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70796
121	IVS I [3' end] (-17 bp) (17 bp deletion)	N/A	HBB:c.93-17_93-1delTATTTTCCCACCCTTAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70800
114	IVS I-116 (T>G)	N/A	HBB:c.93-15T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70802
124	IVS I [3' end] (+22bp)	N/A	NG_000007.3:g.70807_70828dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70807
115	IVS I-128 (T>G)	N/A	HBB:c.93-3T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70814
116	IVS I-129 (A>C)	N/A	HBB:c.93-2A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70815
117	IVS I-129 (A>G)	N/A	HBB:c.93-2A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70815
118	IVS I-130 G>C	N/A	HBB:c.93-1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70816
119	IVS I-130 (G>A)	N/A	HBB:c.93-1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70816
125	CD 30/31 +CGG [+Arg]	N/A	HBB:c.93_94insCGG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70817
126	CD 31 (-C)	N/A	HBB:c.94delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70818
127	CD 32 CTG>CAG: CD 98 GTG>ATG	Hb Medicine Lake	HBB:c.[98T>A; 295G>A]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70822
131	CD 33-35 (-TGGTCT)	Hb Dresden	HBB:c.101_106delTGGTCT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70825
129	CD 33/34 (GTGGTC>GTC)	Hb Korea	HBB:c.102_104del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70826
130	CD 33-34 (-G)	N/A	HBB:c.102_103delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70826
132	CD 35 TAC>TGC [Tyr>Cys]	N/A	HBB:c.107A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70831
133	CD 35 TAC>TAA	N/A	HBB:c.108C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70832
128	CD 36 CCT>C-T (CD 36 (-C))	N/A	HBB:c.110del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70834
135	CD 36-39 (-8 bp)	N/A	HBB:c.111_118delTTGGACCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70835
134	CD 36/37 (-T)	N/A	HBB:c.112delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70836
138	CD 37 (TGG>TAG)	N/A	HBB:c.113G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70837
136	CD 37 (-G)	N/A	HBB:c.114delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
137	CD 37 (TGG>TGA)	N/A	HBB:c.114G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
139	CD 37-39 (-7 bp): (-GACCCAG)	N/A	HBB:c.114_120del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
141	CD 38/39 (-CC)	N/A	HBB:c.117_118delCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70841
140	CD 38/39 (-C)	N/A	HBB:c.118delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
142	CD 39 CAG>TAG [Gln>STOP]	N/A	HBB:c.118C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
2393	CD 39 -A	N/A	HBB:c.119delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70843
143	CD 40 (-G)	N/A	HBB:c.123delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
144	CD 40 (+86 bp) (HGSA)	N/A	HBB:c.123_208dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
145	CD 40/41 (+T)	N/A	HBB:c.125dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70849
146	CD 41 (-C)	N/A	HBB:c.126delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
147	CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT))	N/A	HBB:c.126_129delCTTT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
148	CD 42/43 (+T)	N/A	HBB:c.129dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70853
149	CD 42/43 (+G)	N/A	HBB:c.130dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
150	CD 43 (GAG>TAG)	N/A	HBB:c.130G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
151	CD 44 -C	N/A	HBB:c.135delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70859
152	CD 45 (-T)	N/A	HBB:c.138delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
153	CD 45 (+T)	N/A	HBB:c.138dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
154	CD 45/46 (+A)	N/A	HBB:c.138_139insA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
155	CD 47 (+A)	N/A	HBB:c.143dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
156	CD 47/48 (+ATCT)	N/A	HBB:c.143_146dupATCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
2187	CD 48 -T	N/A	HBB:c.146delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70870
157	CD 49 (-C)	N/A	HBB:c.150delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70874
158	CD 50 (-T)	N/A	HBB:c.153delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70877
159	CD 51 (-C)	N/A	HBB:c.155delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70879
160	CD 53 (-T)	N/A	HBB:c.162delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70886
161	CD 53/54 (+G)	N/A	HBB:c.163dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70887
162	CD 54 -T	N/A	HBB:c.165delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
164	CD 54-58 (-13bp)	N/A	HBB:c.165_177delTATGGGCAACCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
163	CD 54/55 (+A)	N/A	HBB:c.166dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
165	CD 55 (-A)	N/A	HBB:c.166delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
166	CD 56-60 (+14 bp)	N/A	HBB:c.170_183dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70894
167	CD 58 (+C)	N/A	HBB:c.176dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70900
169	CD 59 (AAG>TAG)	N/A	HBB:c.178A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70902
168	CD 59 -A	N/A	HBB:c.179delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70903
170	CD 60 GTG>GAG [Val>Glu]	Hb Cagliari	HBB:c.182T>A	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70906
172	CD 61 (AAG>TAG)	N/A	HBB:c.184A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70908
2190	CD 62-83 (+65 bp)	N/A	HBB:c.187_251dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70911
171	CD 62-64 (-7bp)	N/A	HBB:c.189_195delTCATGGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70913
173	CD 64 (-G)	N/A	HBB:c.194delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70918
2188	CD 66 -A	N/A	HBB:c.201delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70925
175	CD 67 (-TG)	N/A	HBB:c.203_204delGT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70927
2522	CD 69 GGT>G-T	N/A	HBB:c.209delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70933
2189	CD 69 -T	N/A	HBB:c.210delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70934
176	CD 71 (+T)	N/A	HBB:c.216dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70940
177	CD 71/72 (+A)	N/A	HBB:c.217dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
178	CD 72-73 (-AGTGA, +T)	N/A	HBB: c.217_221delAGTGAinsT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
2181	CD 72/73 (+T)	N/A	HBB:c.219dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70943
179	CD 75 (-C)	N/A	HBB:c.226delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70950
180	CD 76 GCT>--T (-GC)	N/A	HBB:c.229_230delGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70953
181	CD 76 (-C)	N/A	HBB:c.230delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70954
182	CD 78 CTG>-TG	N/A	HBB:c.235delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70959
3225	CD 78/85 (-20bp)	N/A	HBB:c.237_256delGGACAACCTCAAGGGCACCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70961
183	CD 80/81 (-C)	N/A	HBB:c.244delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
184	CD 81-87 (-22 bp)	N/A	HBB:c.244_265del22	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
185	CD 82/83 (-G)	N/A	HBB:c.251delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70975
186	CD 84-86 (-8 bp): (-CACCTTTG)	N/A	HBB:c.253_260del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70977
187	CD 84/85 (+C)	N/A	HBB:c.255dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70979
188	CD 84-86 (+T)	N/A	HBB:c.258dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70982
189	CD 88 (+T)	N/A	HBB:c.266dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
190	CD 88 (-TG)	N/A	HBB:c.266_267del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
191	CD 89/90 (AGTGAG>AGAG)	N/A	HBB:c.270_271del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70994
192	CD 90 GAG>TAG	N/A	HBB:c.271G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70995
3133	IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu]	N/A	HBB:c.[315+1G>A; 274C>T]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70998, 71040
193	CD 91 CTG>C-G	Hb Morgantown	HBB:c.275del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
194	CD 91 (+T)	N/A	HBB:c.275dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
195	CD 93/94 (+TG)	Hb Agnana	HBB:c.282_283dupTG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71006
196	CD 95 (+A)	N/A	HBB:c.287dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71011
198	CD 100 (-CC,+TCTGAGAACTT) >158aa	N/A	HBB:c.301_302delCCinsTCTGAGAACTT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71025
2279	CD 102 AAC>ATCAC	N/A	HBB:c.308insTC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71032
199	IVS II-1 (-G)	N/A	HBB:c.315+1delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
200	IVS II-1 G>A	N/A	HBB:c.315+1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
201	IVS II-1 G>C	N/A	HBB:c.315+1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
202	IVS II-1 G>T	N/A	HBB:c.315+1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
203	IVS II-2 T>C	N/A	HBB:c.315+2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
204	IVS II-2 (T>A)	N/A	HBB:c.315+2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
205	IVS II-2 (-T)	N/A	HBB:c.315+2del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
2182	IVS II-2 -TGAGTCTATGGG	N/A	HBB:c.315+2_315+13delTGAGTCTATGGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
3226	IVS II-2 T>G	N/A	HBB:c.315+2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
207	IVS II 4/5 -AG	N/A	NG_000007.3:g.71043_71044delAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71043
208	IVS II-5 (G>C)	N/A	HBB:c.315+5G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71044
3996	4.9 Kb deletion (NG_000007.3:g.71429_76331del)	N/A	NC_000011.10:g.5226187_5231089del	β	Causative	β-thalassaemia, Ineffective erythropoiesis	NG_000007.3	71429
209	IVS II-535 - CD 108 (+23, -310, +28)	Hb Jambol	HBB:c.[316-300_327delinsCAGGTGCCATCTGTCACCCTTTTCTTTG;316-316_316-315insAATATATTTTTAATATACTTTTT]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71590
286	619 bp deletion (Asian Indian)	N/A	NG_000007.3:g.71609_72227del619	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71609
210	IVS II-613 (C>T)	N/A	HBB:c.316-238C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71652
211	IVS II-654 C>T	N/A	HBB:c.316-197C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71693
212	IVS II-705 (T>G)	N/A	HBB:c.316-146T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71744
213	IVS II-726 A>G	N/A	HBB:c.316-125A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71765
214	IVS II-745 C>G	N/A	HBB:c.316-106C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71784
2200	IVS II-765 L1 insertion (+CTGCTTTTATTTT)	N/A	HBB:c.316-98_316-86dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71792
215	IVS II-761 A>G	N/A	HBB:c.316-90A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71800
2183	IVS II-781 C>G	N/A	HBB:c.316-70C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71820
216	IVS II-815 (C>T)	N/A	HBB:c.316-36C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71854
217	IVS II-837 (T>G)	N/A	HBB:c.316-14T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71876
218	IVS II-843 (T>G)	N/A	HBB:c.316-8T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71882
219	IVS II-844 (C>A)	N/A	HBB:c.316-7C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71883
220	IVS II-844 (C>G)	N/A	HBB:c.316-7C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71883
221	IVS II-848 (C>A)	N/A	HBB:c.316-3C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71887
222	IVS II-848 (C>G)	N/A	HBB:c.316-3C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71887
223	IVS II-849 (A>G)	N/A	HBB:c.316-2A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71888
224	IVS II-849 (A>C)	N/A	HBB:c.316-2A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71888
225	IVS II-850 G>C	N/A	HBB:c.316-1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
226	IVS II-850 (G>A)	N/A	HBB:c.316-1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
227	IVS II-850 (G>T)	N/A	HBB:c.316-1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
228	IVS II-850 (-G)	N/A	HBB:c.316-1delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
229	CD 106 (CTG >GTG) Leu to Val (Hb Federico II)	Hb L'Aquila	HBB:c.319C>G	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71893
230	CD 106 CTG>CGG [Leu>Arg]	Hb Terre Haute	HBB:c.320T>G	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71894
231	CD 107 (+G)	N/A	HBB:c.323dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
2191	CD 107-111 (-12 bp): (-GCAACGTGCTGG)	N/A	HBB:c.323_334del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
232	CD 108-112 (-12 bp) Asn-Val-Leu-Val-Cys to Ser	N/A	HBB:c.326_337delACGTGCTGGTCT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71900
233	CD 109 (-G) >156aa	Hb Manhattan	HBB:c.328delG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71902
234	CD 110 CTG>CCG [Leu>Pro]	Hb Showa-Yakushiji	HBB:c.332T>C	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71906
235	CD 112 (TGT>TGA)	N/A	HBB:c.339T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
2192	CD 114/115 (+TGTGCTG)	N/A	HBB:c.339_345dupTGTGCTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
236	CD 113 (-G) >156aa	N/A	HBB:c.340delG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71914
238	CD 114 (-CT, +G) >156aa	Hb Geneva	HBB:c.343_344delinsG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71917
237	CD 114 CTG>CCG [Leu>Pro] (Hb Brescia)	Hb Durham-N.C.	HBB:c.344T>C	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71918
239	CD 115 (GCC>GAC) Ala to Asp	Hb Hradec Kralove (HK)	HBB:c.347C>A	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71921
3228	CD 116 CAT>-AT	N/A	HBB:c.349del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71923
240	CD 116 (+TGAT)	N/A	HBB:c.349_350insTGAT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71924
2193	CD 117 -C	N/A	HBB:c.354delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71928
241	CD 118 (-T) > 156aa	Hb Sainte Seve	HBB:c.357delT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71931
242	CD 120 -A [156 aa] (CD 120 AAA>AA-)	Hb Filottrano	HBB:c.363delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71937
243	CD 120/121 (+A)	N/A	HBB:c.363dupA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71937
244	CD 121 GAA>TAA (120aa)	N/A	HBB:c.364G>T	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71938
245	CD 123 (-A) >156aa	Hb Makabe	HBB:c.370delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71944
246	CD 123-125 (-ACCCCACC) >135aa	Hb Khon Kaen	HBB:c.370_378delACCCCACCA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71944
247	CD 124 (-A) >156aa	N/A	HBB:c.375delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
2194	CD 124/125 (+A)	N/A	HBB:c.375dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
248	CD 125 (+CCA)	N/A	HBB:c.376_378dupCCA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71950
3227	CD 125-126 (+CCAGT)	N/A	HBB:c.376_380dupCCAGT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71950
2195	CD 125-127 (-CAGTGC)	N/A	HBB:c.377_382delCAGTGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71951
249	CD 125 (-A) >156aa	N/A	HBB:c.378delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71952
3563	CD 126 GTG>-TG	N/A	HBB:c.379delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71953
250	CD 126 (-T) >156aa	Hb Vercelli	HBB:c.380delT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71954
1235	CD 126 GTG>GGG [Val>Gly] (Hb Neapolis)	Hb Dhonburi	HBB:c.380T>G	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71954
255	CD 127 CAG>TAG [Gln>STOP]	N/A	HBB:c.382C>T	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71956
253	CD 127 (CAG>CCG) Gln to Pro	Hb Houston	HBB:c.383A>C	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71957
254	CD 127 CAG>CGG [Gln>Arg]	Hb Dieppe	HBB:c.383A>G	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71957
256	CD 127/128 -AGG [Glu-Ala>Pro]	Hb Gunma	HBB:c.383_385delAGG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71957
257	CD 128/129 (-4, +5, -11 bp) >153aa	N/A	HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71959
1241	CD 128 GCT>CCT	Hb Mont Saint Aignan	HBB:c.385G>C	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71959
2196	CD 130 TAT>TAA [Tyr>STOP]	N/A	HBB:c.393T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71967
258	CD 131 (CAG>TAG)	N/A	HBB:c.394C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71968
2197	CD 131 (+A)	N/A	HBB:c.395dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71969
259	CD 131/132 (+GCCT)	N/A	HBB:c.396_397insGCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
260	CD 131-132 (-GA) >138aa	N/A	HBB:c.396_397delGA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
261	CD 131-134 (-11bp) >134aa	N/A	HBB:c.396_406del	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71970
262	CD 132 (AAA>TAA)	N/A	HBB:c.397A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71971
1257	CD 132 AAA>CAA [Lys>Gln]	Hb K Woolwich	HBB:c.397A>C	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71971
263	CD 134-137 (-12, +6 bp) Val-Ala-Gly-Val to Gly-Arg	N/A	HBB:c.404_413delinsGCAG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71978
1264	CD 134 GTG>GAG	Hb North Shore	HBB:c.404T>A	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71978
264	CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp	Hb Stara Zagora	HBB:c.413_418delTGGCTA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71987
3361	CD 138/139 (+T)	N/A	HBB:c.417dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71991
2282	CD 139/140 +T [163 aa]	Hb Boston-Kuwait	HBB:c.420dupT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71994
265	CD 141 (-C) >156aa	Hb Florida	HBB:c.424delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71998
1290	CD 142 (-CC)	Hb Uzes	HBB:c.429_430delCC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72003
2024	CD 143 (-C)	Hb Montreal II	HBB:c.430delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72004
267	3'UTR +6 C>G (Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G)	N/A	HBB:c.*6C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72024
2177	3'UTR +32 A>C (3'UTR +1506 (A>C), Terminal CD +32 A>C)	N/A	HBB:c.*32A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72050
268	3'UTR +47 C>G (Terminal CD +47 C>G)	N/A	HBB:c.*47C>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72065
269	3'UTR -13 bp [CAP +1567 to +1579]	N/A	HBB:c.93_105delATCTGGATTCTGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72111
270	Poly A (A>C) AATAAA>CATAAA	N/A	HBB:c.*108A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72126
271	Poly A (A>G) AATAAA>GATAAA	N/A	HBB:c.*108A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72126
272	Poly A (T>C) AATAAA>AACAAA	N/A	HBB:c.*110T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
273	Poly A (T>A) AATAAA>AAAAAA	N/A	HBB:c.*110T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
277	Poly A (-TA); (AATAAA>AAAA)	N/A	HBB:c.110_111delTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
278	Poly A (-AATAA) (polyA (-TAAAA))	N/A	HBB:c.110_114del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
4025	Poly A (-T) AATAAA>AA-AAA	N/A	HBB:c.*110del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72128
274	Poly A (A>G) AATAAA>AATGAA	N/A	HBB:c.*111A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72129
275	Poly A (A>G) AATAAA>AATAGA	N/A	HBB:c.*112A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72130
2198	Poly A (A>T) AATAAA>AATATA	N/A	HBB:c.*112A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72130
276	Poly A (A>G) AATAAA>AATAAG	N/A	HBB:c.*113A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72131

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.