IthaID: 3740



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: -5 C>T HGVS Name: HBA1:c.-42C>T

Context nucleotide sequence:
AGCATAAACCCTGGCGCGCTCGCGGC [C/T] CGGCACTCTTCTGGTCCCCACAGACTC (Strand: +)

Also known as:

Comments: The -5 C>T found in one of the α3.7 hybrid gene of a homozygous patient of -α3.7 deletion presented with hypochromic microcytic anemia (MCV 64.6 fL, MCH 20.9 pg), low HbA2 1.3% and a normal ferritin value.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37538
Size: 1 bp
Located at: α1
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Omani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Hassan SM, Harteveld CL, Bakker E, Giordano PC, Molecular spectrum of α-globin gene defects in the Omani population., Hemoglobin, 38(6), 422-6, 2014 PubMed
Created on 2021-02-12 15:40:09, Last reviewed on 2021-02-24 19:47:06 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.