IthaID: 3445

Names and Sequences

Functionality:	Neutral polymorphism	Pathogenicity:	Benign / Likely Benign
Common Name:	IVS I-13 G>T	HGVS Name:	HBB:c.92+13G>T

Context nucleotide sequence:
GCCCTGGGCAGGTTGGTATCAAG [G/T] TTACAAGACAGGTTTAAGGAGAC (Strand: -)

Also known as:

Comments: This mutation is an innocuous SNP associated with a well-characterised cryptic splice donor site in HBB. The cryptic splice donor is activated by mutations IthaID 101, 102, 103, 107 and 111, leading to aberrant splicing, inclusion of intronic material in the HBB mRNA and beta-thalassaemia. Mutations IthaID 107 and 111 retain residual normal splicing activity, and in their presence this SNP may thus conceivably increase normal splicing and ameliorate the associated phenotype.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP	LOVD
ClinVar

Phenotype

Allele Phenotype:	Neutral
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70699
Size:	1 bp
Located at:	β
Specific Location:	Intron 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	N/A
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983 PubMed

Created on 2019-09-23 12:41:56, Last reviewed on 2020-09-28 16:56:43 (Show full history)

A/A	Date	Curator(s)	Comments
1	2019-09-23 12:41:56	The IthaGenes Curation Team	Created
2	2020-09-28 16:56:43	The IthaGenes Curation Team	Reviewed. Inheritance added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.