IthaID: 3445
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | IVS I-13 G>T | HGVS Name: | HBB:c.92+13G>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCCCTGGGCAGGTTGGTATCAAG [G/T] TTACAAGACAGGTTTAAGGAGAC (Strand: -)
Comments: This mutation is an innocuous SNP associated with a well-characterised cryptic splice donor site in HBB. The cryptic splice donor is activated by mutations IthaID 101, 102, 103, 107 and 111, leading to aberrant splicing, inclusion of intronic material in the HBB mRNA and beta-thalassaemia. Mutations IthaID 107 and 111 retain residual normal splicing activity, and in their presence this SNP may thus conceivably increase normal splicing and ameliorate the associated phenotype.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70699 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983 PubMed
Created on 2019-09-23 12:41:56,
Last reviewed on 2020-09-28 16:56:43 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.