IthaID: 2922



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1800797 HGVS Name: NG_011640.1:g.4456A>G

Context nucleotide sequence:
TGAAGTAACTGCACGAAATTTGAGG [A/G] TGGCCAGGCAGTTCTACAACAGCCG (Strand: +)

Also known as: -597G>A

Comments: SNP (A allele) associated with a protective effect against retinopathy in patients with sickle cell anaemia (SCA) from Brazil.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Retinopathy [HP:0000488]

Location

Chromosome: 7
Locus: NG_011640.1
Locus Location: 4456
Size: 1 bp
Located at: IL6
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Vicari P, Adegoke SA, Mazzotti DR, Cançado RD, Nogutti MA, Figueiredo MS, Interleukin-1β and interleukin-6 gene polymorphisms are associated with manifestations of sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 244-9, 2015 PubMed
Created on 2016-05-26 12:04:00, Last reviewed on 2017-07-19 11:01:06 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.