IthaID: 233



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 109 (-G) >156aa HGVS Name: HBB:c.328delG
Hb Name: Hb Manhattan Protein Info: β 109 (-G); modified C-terminal sequence: (109)Cys-Trp-Ser-Val-Cys-Trp-Pro-Ile-Thr-Leu- Ala-Lys-Asn-Ser-Pro-His-Gln-Cys-Arg-Leu- Pro-Ile-Arg-Lys-Trp-Trp-Leu-Val-Trp-Leu- Met-Pro-Trp-Pro-Thr-Ser-Ile-Thr-Lys-Leu- Ala-Phe-Leu-Leu-Ser-Asn-Phe-(156)Tyr-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTTCCTCCCACAGCTCCTGGGCAAC [-/G] TGCTGGTCTGTGTGCTGGCCCATCA (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71902
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Lithuanian, British, Ashkenazi
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Kazazian HH, Dowling CE, Hurwitz RL, Coleman M, Stopeck A, Adams JG, Dominant thalassemia-like phenotypes associated with mutations in exon 3 of the beta-globin gene., Blood, 79(11), 3014-8, 1992 PubMed
  2. Knott M, Ramadan KM, Savage G, Jones FG, El-Agnaf M, McMullin MF, Percy MJ, Novel and Mediterranean beta thalassemia mutations in the indigenous Northern Ireland population., Blood cells, molecules & diseases, 36(2), 265-8, 2006 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.