IthaGenes

Loading... Please wait!

Quick filtering

Showing all entries with β0 phenotype (Show All):

IthaID	Common Name	Hb Name	HGVS Name	Genes	Functionality	Phenotype	Locus	Position
3393	3.5 kb deletion (Thai, 3485 bp deletion)	N/A	NC_000011.10:g.5224302_5227791del3490bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3
291	Czech (4237 bp deletion)	N/A	NG_000007.3:g.67258_71501del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
293	Cape Verdean	N/A	NG_000007.3:g.71548_79271del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
294	Asian Indian (10329 bp deletion)	N/A	NG_000007.3:g.(67531_67533)_(77874_77876)del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
295	Australian (Anglo Saxon) (12023 bp deletion)	N/A	NC_000011.10:g.5215894_5227926del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
299	Italian (~67 kb deletion)	N/A	N/A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
2123	7719 bp deletion	N/A	NG_000007.3:g.71550_79270del7719	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	0
3792	N/A	Hb Lepore-Hong Kong	NG_000007.3:g.63154_70565del	δ, β	Causative	δβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	63154
4109	N/A	Hb Lepore-Quanzhou	NG_000007.3:g.63511_70924del	δ, β	Causative	δβ-thalassaemia	NG_000007.3	63511
3394	223 kb deletion	N/A	NC_000011.10:g.5010012_5232933del	δ, β	Causative	β-thalassaemia	NG_000007.3	64683
3958	8.2 kb deletion	N/A	NG_000007.3:g.65147_73407del	β	Causative	β-thalassaemia	NG_000007.3	65147
298	Filipino (~45 kb deletion)	N/A	NC_000011.10:g.5112882 _5231358del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66258
292	Turk (~7.6 kb deletion)	N/A	NG_000007.3:g.[52524_60162del;66278_73952del]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66278
2283	South-Italy	N/A	NC_000011.10:g.5164564_5230714del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	66902
3997	7.2 kb deletion	N/A	NC_000011.10:g.5222800_5230034del	β	Causative	β-thalassaemia	NG_000007.3	67582
296	Dutch (12620 bp deletion)	N/A	NG_000007.3:g.68071_80682del12612	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	68071
3823	60 kb deletion (Prachinburi β0-thalassemia deletion)	N/A	NC_000011.10:g.5167971_5228123delinsA	β	Causative	β-thalassaemia	NG_000007.3	69493
289	Croatian (1605 bp deletion)	N/A	NG_000007.3:g.69561_71164del1604	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	69561
290	Thai (3485 bp deletion, Chongqing deletion, NC_000011.10: g.5224303-5227790del, NC_000011.9: g.5245533_5249020del)	N/A	NG_000007.3:g.69826_73313del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	69826
288	Black, British (1393 bp deletion)	N/A	NG_000007.3:g.70060_71452del1393	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70060
2125	Afghan (909 bp deletion)	N/A	NG_000007:g.70067_70976del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70067
284	468 bp deletion	N/A	NG_000007.3:g.70070_70537del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70070
285	Black (532 bp deletion)	N/A	HBB:c.-504_28del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70091
3277	538 bp deletion	N/A	HBB:c.-464_74del \| NG_000007.3:g.70131_70668del	β	Causative	β-thalassaemia	NG_000007.3	70131
3278	1517 bp deletion	N/A	HBB:c.-390_316-169delinsA	β	Causative	β-thalassaemia	NG_000007.3	70205
2122	125 bp deletion	N/A	NG_000007.3:g.70360_70485del125	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70360
2153	Kabylia deletion/insertion	N/A	NG_000007.3:g.70417_72458delinsATAAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70417
283	290 bp deletion	N/A	HBB:c.-176_92+25del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70419
282	105 bp deletion	N/A	HBB:c.-74_31del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70521
42	Init CD ATG>GTG	N/A	HBB:c.1A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70595
43	Init CD ATG>CTG	N/A	HBB:c.1A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70595
44	Init CD ATG>ACG	N/A	HBB:c.2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
45	Init CD ATG>AGG	N/A	HBB:c.2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
46	Init CD ATG>AAG	N/A	HBB:c.2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70596
47	Init CD ATG>ATC	N/A	HBB:c.3G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
48	Init CD ATG>ATA	N/A	HBB:c.3G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
49	Init CD ATG>ATT	N/A	HBB:c.3G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70597
50	CD 1 (-G)	N/A	HBB:c.4delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70598
51	CD 2-4 (-9 bp, +31 bp)	N/A	HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
3437	CD 2 CAT>-AT	Hb Bundelkhand	HBB:c.7delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70601
3014	CD 2 CAT>C-T	N/A	HBB:c.8delA	β	Causative	β-thalassaemia	NG_000007.3	70602
3561	CD 2 CAT/CA-	N/A	HBB:c.9delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70603
52	CD 3 (+T)	N/A	HBB:c.11dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70605
55	CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG)	N/A	HBB:c.[15T>A;16C>T;19G>T]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70609, 70610, 70613
54	CD 5 -CT	N/A	HBB:c.17_18delCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70611
2180	CD 5/6 -TG	N/A	HBB:c.18_19delTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70612
56	CD 6 (GAG>TAG)	N/A	HBB:c.19G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
2184	CD 6-14 (-26 bp) (26 bp deletion)	N/A	HBB:c.20_45del26bp	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70613
57	CD 6 -A	N/A	HBB:c.20delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
58	CD 6 (-G)	N/A	HBB:c.20delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70614
59	CD 6-10 (-13 bp)	N/A	HBB:c.21_33delGGAGAAGTCTGCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70615
60	CD 7 GAG>TAG	N/A	HBB:c.22G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70616
2958	CD 7/8 (+G)	N/A	HBB:c.24dupG	β	Causative	β-thalassaemia	NG_000007.3	70618
61	CD 8 (-AA)	N/A	HBB:c.25_26delAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70619
2185	CD 8/9 +AGAA	N/A	HBB:c.27_28insAGAA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70620
62	CD 8/9 (+G)	N/A	HBB:c.27dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
3513	CD 8 AAG>AA-	N/A	HBB:c.27delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70621
63	CD 9 (+TA)	N/A	HBB:c.28_29insTA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70622
64	CD 9/10 (+T)	Hb Gaziantep	HBB:c.30dupT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70624
66	CD 10 (-C)	N/A	HBB:c.33delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70627
67	CD 11 (-T)	N/A	HBB:c.36delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70630
68	CD 14 (+T)	N/A	HBB:c.44dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
2553	CD 14 CTG>C-G	N/A	HBB:c.44delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70638
69	CD 14/15 (+G)	N/A	HBB:c.45dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70639
70	CD 15 (-T)	N/A	HBB:c.46delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70640
72	CD 15 TGG>TAG	N/A	HBB:c.47G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70641
73	CD 15 TGG>TGA	N/A	HBB:c.48G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70642
71	CD 15/16 (+G)	N/A	HBB:c.50dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
74	CD 15/16 (-G)	N/A	HBB:c.50delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70644
75	CD 16 GGC>GG-	N/A	HBB:c.51delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70645
77	CD 17 AAG>TAG [Lys>STOP]	N/A	HBB:c.52A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70646
78	CD 17 (+A)	N/A	HBB:c.53dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70647
3609	CD 20/21 (-TGGA)	N/A	HBB:c.62_65delTGGA	β	Causative	β-thalassaemia	NG_000007.3	70656
81	CD 20/21 (+G)	N/A	HBB:c.64dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70658
83	CD 22 (GAA>TAA)	N/A	HBB:c.67G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70661
84	CD 22-24 ( -7 bp): (-AAGTTGG)	N/A	HBB:c.68_74delAAGTTGG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70662
85	CD 24 (-G, +CAC)	N/A	HBB:c.74delinsCAC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
2174	CD 24 -G	N/A	HBB:c.74delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70668
281	IVS I [3 end] -44 bp (44 bp deletion)	N/A	HBB:c.76_92+27del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70670
87	CD 25/26 (+T)	N/A	HBB:c.78dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70672
89	CD 26 (GAG>TAG)	N/A	HBB:c.79G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
90	CD 26 (+T)	N/A	HBB:c.79_80insT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70673
92	CD 27/28 (+C)	N/A	HBB:c.85dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
93	CD 28 (-C)	N/A	HBB:c.85delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70679
95	CD 28/29 (-G)	N/A	HBB:c.89delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70683
97	CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly)	N/A	HBB:c.91A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
3484	CD 30 (-A) or IVS I (-2) AGG>-GG	N/A	HBB:c.91delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70685
99	CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys)	N/A	HBB:c.92G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70686
100	CD 30 (G>C) or IVS I (-1) AGG>ACG (Arg>Thr) (Hb Kairouan)	Hb Monroe	HBB:c.92G>C	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70686
101	IVS I-1 G>A	N/A	HBB:c.92+1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
102	IVS I-1 (G>T)	N/A	HBB:c.92+1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
103	IVS I-1 (G>C)	N/A	HBB:c.92+1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70687
104	IVS I-2 (T>G)	N/A	HBB:c.92+2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
105	IVS I-2 (T>C)	N/A	HBB:c.92+2T>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
106	IVS I-2 (T>A)	N/A	HBB:c.92+2T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70688
107	IVS I-5 (G>C)	N/A	HBB:c.92+5G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70691
280	IVS I [3' end] (-25 bp) (25 bp deletion)	N/A	NC_000011.10(NM_000518.4):c.93-22_95del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70795
121	IVS I [3' end] (-17 bp) (17 bp deletion)	N/A	HBB:c.93-17_93-1delTATTTTCCCACCCTTAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70800
114	IVS I-116 (T>G)	N/A	HBB:c.93-15T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70802
124	IVS I [3' end] (+22bp)	N/A	NG_000007.3:g.70807_70828dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70807
116	IVS I-129 (A>C)	N/A	HBB:c.93-2A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70815
117	IVS I-129 (A>G)	N/A	HBB:c.93-2A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70815
118	IVS I-130 G>C	N/A	HBB:c.93-1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70816
119	IVS I-130 (G>A)	N/A	HBB:c.93-1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70816
125	CD 30/31 +CGG [+Arg]	N/A	HBB:c.93_94insCGG	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70817
126	CD 31 (-C)	N/A	HBB:c.94delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70818
130	CD 33-34 (-G)	N/A	HBB:c.102_103delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70826
132	CD 35 TAC>TGC [Tyr>Cys]	N/A	HBB:c.107A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70831
133	CD 35 TAC>TAA	N/A	HBB:c.108C>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70832
3023	CD 35 TAC>TAG	N/A	HBB:c.108C>G	β	Causative	β-thalassaemia	NG_000007.3	70832
128	CD 36 CCT>C-T (CD 36 (-C))	N/A	HBB:c.110del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70834
135	CD 36-39 (-8 bp)	N/A	HBB:c.111_118delTTGGACCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70835
134	CD 36/37 (-T)	N/A	HBB:c.112delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70836
138	CD 37 (TGG>TAG)	N/A	HBB:c.113G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70837
136	CD 37 (-G)	N/A	HBB:c.114delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
137	CD 37 (TGG>TGA)	N/A	HBB:c.114G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
139	CD 37-39 (-7 bp): (-GACCCAG)	N/A	HBB:c.114_120del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70838
141	CD 38/39 (-CC)	N/A	HBB:c.117_118delCC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70841
140	CD 38/39 (-C)	N/A	HBB:c.118delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
142	CD 39 CAG>TAG [Gln>STOP]	N/A	HBB:c.118C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70842
2393	CD 39 -A	N/A	HBB:c.119delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70843
143	CD 40 (-G)	N/A	HBB:c.123delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
144	CD 40 (+86 bp) (HGSA)	N/A	HBB:c.123_208dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70847
145	CD 40/41 (+T)	N/A	HBB:c.125dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70849
146	CD 41 (-C)	N/A	HBB:c.126delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
147	CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT))	N/A	HBB:c.126_129delCTTT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70850
148	CD 42/43 (+T)	N/A	HBB:c.129dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70853
2954	CD 42 TTT>TT-	Hb Yala	HBB:c.129delT	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	70853
149	CD 42/43 (+G)	N/A	HBB:c.130dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
150	CD 43 (GAG>TAG)	N/A	HBB:c.130G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70854
3594	CD 43 (GAG>TAG);CD 71/72 (+A)	N/A	HBB:c.[130G>T;217dupA]	β	Causative	β-thalassaemia	NG_000007.3	70854, 70941
151	CD 44 -C	N/A	HBB:c.135delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70859
152	CD 45 (-T)	N/A	HBB:c.138delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
153	CD 45 (+T)	N/A	HBB:c.138dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70862
2960	CD 46/47 (+G)	N/A	HBB:c.142_142dupG	β	Causative	β-thalassaemia	NG_000007.3	70866
155	CD 47 (+A)	N/A	HBB:c.143dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
156	CD 47/48 (+ATCT)	N/A	HBB:c.143_146dupATCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70867
2187	CD 48 -T	N/A	HBB:c.146delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70870
157	CD 49 (-C)	N/A	HBB:c.150delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70874
3940	CD 50 ACT>TCT [Thr>Ser]; IVS II-654 C>T	Hb Zurich-Langstrasse	HBB:c.[151A>T;316-197C>T]	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	70875, 71693
158	CD 50 (-T)	N/A	HBB:c.153delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70877
159	CD 51 (-C)	N/A	HBB:c.155delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70879
2959	CD 52 GAT>G-T	N/A	HBB:c.158delA	β	Causative	β-thalassaemia	NG_000007.3	70882
161	CD 53/54 (+G)	N/A	HBB:c.163dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70887
162	CD 54 -T	N/A	HBB:c.165delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
164	CD 54-58 (-13bp)	N/A	HBB:c.165_177delTATGGGCAACCCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70889
163	CD 54/55 (+A)	N/A	HBB:c.166dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
165	CD 55 (-A)	N/A	HBB:c.166delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70890
2990	CD 55-59 (-13 bp)	N/A	HBB:c.167_179del	β	Causative	β-thalassaemia	NG_000007.3	70891
166	CD 56-60 (+14 bp)	N/A	HBB:c.170_183dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70894
167	CD 58 (+C)	N/A	HBB:c.176dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70900
3311	CD 58 CCT>C-T	N/A	HBB:c.176delC	β	Causative	β-thalassaemia	NG_000007.3	70900
169	CD 59 (AAG>TAG)	N/A	HBB:c.178A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70902
168	CD 59 -A	N/A	HBB:c.179delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70903
172	CD 61 (AAG>TAG)	N/A	HBB:c.184A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70908
2190	CD 62-83 (+65 bp)	N/A	HBB:c.187_251dup	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70911
171	CD 62-64 (-7bp)	N/A	HBB:c.189_195delTCATGGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70913
173	CD 64 (-G)	N/A	HBB:c.194delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70918
3944	CD 64 (+G)	N/A	HBB:c.194dup	β	Causative	β-thalassaemia	NG_000007.3	70918
174	CD 66 AAA>TAA [Lys>STOP]	N/A	HBB:c.199A>T	β	Causative	β-thalassaemia	NG_000007.3	70923
3854	CD 66/67 (-AAAG)	N/A	HBB:c.199_202delAAAG	β	Causative	β-thalassaemia	NG_000007.3	70923
2188	CD 66 -A	N/A	HBB:c.201delA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70925
175	CD 67 (-TG)	N/A	HBB:c.203_204delGT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70927
2522	CD 69 GGT>G-T	N/A	HBB:c.209delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70933
2189	CD 69 -T	N/A	HBB:c.210delT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70934
176	CD 71 (+T)	N/A	HBB:c.216dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70940
2462	CD 71 -T	N/A	HBB:c.216delT	β	Causative	β-thalassaemia	NG_000007.3	70940
177	CD 71/72 (+A)	N/A	HBB:c.217dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
178	CD 72-73 (-AGTGA, +T)	N/A	HBB: c.217_221delAGTGAinsT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70941
2181	CD 72/73 (+T)	N/A	HBB:c.219dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70943
179	CD 75 (-C)	N/A	HBB:c.226delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70950
180	CD 76 GCT>--T (-GC)	N/A	HBB:c.229_230delGC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70953
181	CD 76 (-C)	N/A	HBB:c.230delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70954
182	CD 78 CTG>-TG	N/A	HBB:c.235delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70959
3299	CD 77/78 (+C)	N/A	HBB:c.235dupC	β	Causative	β-thalassaemia	NG_000007.3	70959
3225	CD 78/85 (-20bp)	N/A	HBB:c.237_256delGGACAACCTCAAGGGCACCT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70961
183	CD 80/81 (-C)	N/A	HBB:c.244delC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
184	CD 81-87 (-22 bp)	N/A	HBB:c.244_265del22	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70968
185	CD 82/83 (-G)	N/A	HBB:c.251delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70975
186	CD 84-86 (-8 bp): (-CACCTTTG)	N/A	HBB:c.253_260del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70977
187	CD 84/85 (+C)	N/A	HBB:c.255dupC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70979
188	CD 84-86 (+T)	N/A	HBB:c.258dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70982
3253	CD 88 CTG>--G (HBB:c.265_266delCT)	N/A	HBB:c.265_266del	β	Causative	β-thalassaemia	NG_000007.3	70989
189	CD 88 (+T)	N/A	HBB:c.266dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
190	CD 88 (-TG)	N/A	HBB:c.266_267del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70990
191	CD 89/90 (AGTGAG>AGAG)	N/A	HBB:c.270_271del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70994
192	CD 90 GAG>TAG	N/A	HBB:c.271G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70995
3057	CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG)	N/A	HBB:c.272_295dup	β	Causative	β-thalassaemia	NG_000007.3	70996
3133	IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu]	N/A	HBB:c.[315+1G>A; 274C>T]	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70998, 71040
194	CD 91 (+T)	N/A	HBB:c.275dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	70999
196	CD 95 (+A)	N/A	HBB:c.287dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71011
3888	CD 97/98 (+GCAC)	N/A	HBB:c.291_294dup	β	Causative	β-thalassaemia	NG_000007.3	71015
198	CD 100 (-CC,+TCTGAGAACTT) >158aa	N/A	HBB:c.301_302delCCinsTCTGAGAACTT	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71025
2279	CD 102 AAC>ATCAC	N/A	HBB:c.308insTC	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71032
199	IVS II-1 (-G)	N/A	HBB:c.315+1delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
200	IVS II-1 G>A	N/A	HBB:c.315+1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
201	IVS II-1 G>C	N/A	HBB:c.315+1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
202	IVS II-1 G>T	N/A	HBB:c.315+1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71040
205	IVS II-2 (-T)	N/A	HBB:c.315+2del	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
206	IVS II-2/3 (-2 bp, +11 bp) (IVS II-2,3 (+11/-2))	N/A	HBB:c.315+2_315+3delinsACGTTCTCTGA	β	Causative	β-thalassaemia	NG_000007.3	71041
3226	IVS II-2 T>G	N/A	HBB:c.315+2T>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71041
207	IVS II 4/5 -AG	N/A	NG_000007.3:g.71043_71044delAG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71043
3996	4.9 Kb deletion (NG_000007.3:g.71429_76331del)	N/A	NC_000011.10:g.5226187_5231089del	β	Causative	β-thalassaemia, Ineffective erythropoiesis	NG_000007.3	71429
286	619 bp deletion (Asian Indian)	N/A	NG_000007.3:g.71609_72227del619	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71609
223	IVS II-849 (A>G)	N/A	HBB:c.316-2A>G	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71888
224	IVS II-849 (A>C)	N/A	HBB:c.316-2A>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71888
225	IVS II-850 G>C	N/A	HBB:c.316-1G>C	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
226	IVS II-850 (G>A)	N/A	HBB:c.316-1G>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
227	IVS II-850 (G>T)	N/A	HBB:c.316-1G>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
228	IVS II-850 (-G)	N/A	HBB:c.316-1delG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71889
231	CD 107 (+G)	N/A	HBB:c.323dupG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71897
235	CD 112 (TGT>TGA)	N/A	HBB:c.339T>A	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
2192	CD 114/115 (+TGTGCTG)	N/A	HBB:c.339_345dupTGTGCTG	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71913
240	CD 116 (+TGAT)	N/A	HBB:c.349_350insTGAT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71924
2193	CD 117 -C	N/A	HBB:c.354delC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71928
3846	CD 118 (-TT)	N/A	HBB:c.356_357delTT	β	Causative	β-thalassaemia	NG_000007.3	71930
3555	CD 124 (+C)	N/A	HBB:c.374dup	β	Causative	β-thalassaemia, Haemolytic anaemia	NG_000007.3	71948
2194	CD 124/125 (+A)	N/A	HBB:c.375dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71949
249	CD 125 (-A) >156aa	N/A	HBB:c.378delA	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71952
252	CD 126-131 (-17 bp)	Hb Westdale	HBB:c.380_396delTGCAGGCTGCCTATCAG	β	Causative	β-thalassaemia, β-chain variant	NG_000007.3	71954
254	CD 127 CAG>CGG [Gln>Arg]	Hb Dieppe	HBB:c.383A>G	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71957
257	CD 128/129 (-4, +5, -11 bp) >153aa	N/A	HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC]	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71959
3860	CD 130 TAT>TAG [Tyr>STOP]	N/A	HBB:c.393T>G	β	Causative	β-thalassaemia	NG_000007.3	71967
258	CD 131 (CAG>TAG)	N/A	HBB:c.394C>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71968
2197	CD 131 (+A)	N/A	HBB:c.395dupA	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71969
262	CD 132 (AAA>TAA)	N/A	HBB:c.397A>T	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71971
3361	CD 138/139 (+T)	N/A	HBB:c.417dupT	β	Causative	β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	71991
1290	CD 142 (-CC)	Hb Uzes	HBB:c.429_430delCC	β	Causative	β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis	NG_000007.3	72003

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.