IthaID: 989


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 56-60 (-12bp) HGVS Name: HBB:c.170_181del
Hb Name: Hb Tochigi Protein Info: β 56(D7) - 59(E3) Gly-Asn-Pro-Lys->0

Context nucleotide sequence:
TGTCCACTCCTGATGCTGTTATGG [-/GCAACCCTAAGG] TGAAGGCTCATGGCAAGAAAGT (Strand: -)

Also known as:

Comments: Found in three members of a Japanese family. Reported in literature as HBB:c.169_180delGGCAACCCTAAG, which does not follow the HGVS Sequence Variant Nomeclature recommendations.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70894
Size: 12 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Japanese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Yamada K, Shinkai N, Nakazawa S, Yamada Z, Saito K, Hemoglobin Tochigi disease, a new unstable hemoglobin hemolytic anemia found in a Japanese family., Nippon Ketsueki Gakkai zasshi : journal of Japan Haematological Society, 34(4), 484-97, 1971
Created on 2010-06-16 16:13:16, Last reviewed on 2019-11-11 12:56:56 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.