IthaID: 95


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 28/29 (-G) HGVS Name: HBB:c.89delG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GATGAAGTTGGTGGTGAGGCCCTGG [-/G] CAGGTTGGTATCAAGGTTACAAGA (Strand: -)

Also known as:

Comments: Found in four members of a family from Japan. Found in four different alleles of unrelated patients from Egypt.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70683
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Japanese, Egyptian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997
  2. el-Hashemite N, Petrou M, Khalifa AS, Heshmat NM, Rady MS, Delhanty JD, Identification of novel Asian Indian and Japanese mutations causing beta-thalassaemia in the Egyptian population., Human genetics, 99(2), 271-4, 1997
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-11 11:09:09 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.