
IthaID: 945
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 42 (-TTT) | HGVS Name: | HBB:c.127_129delTTT |
Hb Name: | Hb Bruxelles | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGTCTACCCTTGGACCCAGAGGTTC [-/TTT] GAGTCCTTTGGGGATCTGTCCA (Strand: -)
Comments: Reported in a 4-year-old girl with severe chronic hemolytic anaemia and cyanosis. Abnormal haemoglobin variant by IEF and RP-HPLC. Peptide consisted of two phenylalanine residues instead of three in normal β chains (codons 41, 42, and 45). Sequence analysis showed that the β42 residue is missing. Unstable variant by isopropanol stability test. Low oxygen affinity (P50= 41 mmHg).
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | N/A |
Stability: | Unstable |
Oxygen Affinity: | Decreased Oxygen Affinity |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70851 |
Size: | 3 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Belgian |
Molecular mechanism: | Altered heme pocket |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Blouquit Y, Bardakdjian J, Lena-Russo D, Arous N, Perrimond H, Orsini A, Rosa J, Galacteros F, Hb Bruxelles: alpha 2A beta (2)41 or 42(C7 or CD1)Phe deleted., Hemoglobin, 13(5), 465-74, 1989
- Griffon N, Badens C, Lena-Russo D, Kister J, Bardakdjian J, Wajcman H, Marden MC, Poyart C, Hb Bruxelles, deletion of Phebeta42, shows a low oxygen affinity and low cooperativity of ligand binding., J. Biol. Chem., 271(42), 25916-20, 1996
Created on 2010-06-16 16:13:16,
Last reviewed on 2020-07-01 11:54:50 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.