IthaID: 945

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 42 (-TTT)	HGVS Name:	HBB:c.127_129delTTT
Hb Name:	Hb Bruxelles	Protein Info:	N/A

Context nucleotide sequence:
GGTCTACCCTTGGACCCAGAGGTTC [-/TTT] GAGTCCTTTGGGGATCTGTCCA (Strand: -)

Also known as:

Comments: Reported in a 4-year-old girl with severe chronic hemolytic anaemia and cyanosis. Abnormal haemoglobin variant by IEF and RP-HPLC. Peptide consisted of two phenylalanine residues instead of three in normal β chains (codons 41, 42, and 45). Sequence analysis showed that the β42 residue is missing. Unstable variant by isopropanol stability test. Low oxygen affinity (P50= 41 mmHg).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
dbSNP	dbSNP
OMIM	LOVD

Phenotype

Hemoglobinopathy Group:	Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-chain variant
Allele Phenotype:	N/A
Stability:	Unstable
Oxygen Affinity:	Decreased Oxygen Affinity
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70851
Size:	3 bp
Located at:	β
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Insertion/Deletion of codons (Protein Structure)
Ethnic Origin:	Belgian
Molecular mechanism:	Altered heme pocket
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Blouquit Y, Bardakdjian J, Lena-Russo D, Arous N, Perrimond H, Orsini A, Rosa J, Galacteros F, Hb Bruxelles: alpha 2A beta (2)41 or 42(C7 or CD1)Phe deleted., Hemoglobin, 13(5), 465-74, 1989
Griffon N, Badens C, Lena-Russo D, Kister J, Bardakdjian J, Wajcman H, Marden MC, Poyart C, Hb Bruxelles, deletion of Phebeta42, shows a low oxygen affinity and low cooperativity of ligand binding., J. Biol. Chem., 271(42), 25916-20, 1996

Created on 2010-06-16 16:13:16, Last reviewed on 2020-07-01 11:54:50 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:16	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2020-07-01 11:47:36	The IthaGenes Curation Team	Reviewed. Reference and Comment added. Location corrected.
4	2020-07-01 11:48:02	The IthaGenes Curation Team	Reviewed. DNA info edited.
5	2020-07-01 11:54:50	The IthaGenes Curation Team	Reviewed. Common name and HGVS name corrected.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.