IthaID: 92


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 27/28 (+C) HGVS Name: HBB:c.85dupC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CGTGGATGAAGTTGGTGGTGAGGCCC [-/C] TGGGCAGGTTGGTATCAAGGTTAC (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70679
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese, Thai
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Cai SP, Chui DH, Ng J, Poon AO, Freedman MH, Olivieri NF, A new frameshift beta zero-thalassemia mutation (codons 27-28 +C) found in a Chinese family., American journal of hematology, 37(1), 6-8, 1991
  2. Lin LI, Lin KS, Lin KH, Chang HC, The spectrum of beta-thalassemia mutations in Taiwan: identification of a novel frameshift mutation., American journal of human genetics, 48(4), 809-12, 1991
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-12 13:04:38 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.