IthaID: 9
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | -88 (C>A) | HGVS Name: | HBB:c.-138C>A |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTAGACCTCACCCTGTGGAGCCACA [C>A] CCTAGGGTTGGCCAATCTACTCCCA (Strand: -)
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70457 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Kurds, Pakistani |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Rund D, Cohen T, Filon D, Dowling CE, Warren TC, Barak I, Rachmilewitz E, Kazazian HH, Oppenheim A, Evolution of a genetic disease in an ethnic isolate: beta-thalassemia in the Jews of Kurdistan., Proceedings of the National Academy of Sciences of the United States of America, 88(1), 310-4, 1991
- Rashid A, Tabassum S, Naeem A, Naveed A, Iqbal H, Tabassum S, Rafiq H, A rare and novel mutation in a beta-globin gene of thalassemia patient of Pakistan: A case report., Ann Med Surg (Lond), 84(0), 104918, 2022
Created on 2010-06-16 16:13:14,
Last reviewed on 2023-01-11 11:16:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.