IthaID: 84


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 22-24 ( -7 bp): (-AAGTTGG) HGVS Name: HBB:c.68_74delAAGTTGG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CTGTGGGGCAAGGTGAACGTGGATG [-/AAGTTGG] TGGTGAGGCCCTGGGCAGGTTGGTA (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70662
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Ozçelik H, Başak AN, Tüzmen S, Kirdar B, Akar N, A novel deletion in a Turkish beta-thalassemia patient detected by DGGE and direct sequencing: FSC 22-24 (-7 bp)., Hemoglobin, 17(4), 387-91, 1993
Created on 2010-06-16 16:13:14, Last reviewed on 2016-07-15 11:15:11 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.