IthaID: 83


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 22 (GAA>TAA) HGVS Name: HBB:c.67G>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCTGTGGGGCAAGGTGAACGTGGAT [A/C/G/T] AAGTTGGTGGTGAGGCCCTGGGCAG (Strand: -)

Protein sequence:
MVHLTPEEKSAVTALWGKVNVDX

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70661
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: Reunion Island
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Ghanem N, Girodon E, Vidaud M, Martin J, Fanen P, Plassa F, Goossens M, A comprehensive scanning method for rapid detection of beta-globin gene mutations and polymorphisms., Human mutation, 1(3), 229-39, 1992
Created on 2010-06-16 16:13:14, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.