IthaID: 78

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 17 (+A) HGVS Name: HBB:c.53dup
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTTACTGCCCTGTGGGGCAA [-/Α] GGTGAACGTGGATGAAGTTG (Strand: -)

Comments: The insertion found in an Italian girl associated with the deletion of the 13.4-kb δβ-globin gene region. The insertion of a nt A in codon 17 creates a shift in the reading frame with a premature stop codon at codon 22 (TGA).

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70647
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Feriotto G, Salvatori F, Finotti A, Breveglieri G, Venturi M, Zuccato C, Bianchi N, Borgatti M, Lampronti I, Mancini I, Massei F, Favre C, Gambari R, A novel frameshift mutation (+A) at codon 18 of the beta-globin gene associated with high persistence of fetal hemoglobin phenotype and deltabeta-thalassemia., Acta haematologica, 119(1), 28-37, 2008
Created on 2010-06-16 16:13:14, Last reviewed on 2020-05-05 10:46:07 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.