IthaID: 78
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 17 (+A) | HGVS Name: | HBB:c.53dup |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GTTACTGCCCTGTGGGGCAA [-/Α] GGTGAACGTGGATGAAGTTG (Strand: -)
Comments: The insertion found in an Italian girl associated with the deletion of the 13.4-kb δβ-globin gene region. The insertion of a nt A in codon 17 creates a shift in the reading frame with a premature stop codon at codon 22 (TGA).
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70647 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Feriotto G, Salvatori F, Finotti A, Breveglieri G, Venturi M, Zuccato C, Bianchi N, Borgatti M, Lampronti I, Mancini I, Massei F, Favre C, Gambari R, A novel frameshift mutation (+A) at codon 18 of the beta-globin gene associated with high persistence of fetal hemoglobin phenotype and deltabeta-thalassemia., Acta haematologica, 119(1), 28-37, 2008
Created on 2010-06-16 16:13:14,
Last reviewed on 2020-05-05 10:46:07 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.