IthaID: 775


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 139 (-A) HGVS Name: HBA2:c.420delA
Hb Name: Hb Wayne Protein Info: α2 139 (-A); modified C-terminal sequence: (139)Asn-Thr-Val-Lys-Leu-Glu-Pro-(146)Arg-COOH

Context nucleotide sequence:
CTGTGAGCACCGTGCTGACCTCCAA [A/-] TACCGTTAAGCTGGAGCCTCGGTGG (Strand: +)

Also known as:

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34454
Size: 1 bp
Located at: α2
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Caucasian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

  1. Nachmansohn D, Transduction of chemical into electrical energy., Proc. Natl. Acad. Sci. U.S.A. , 73(1), 82-5, 1976
  2. Huisman TH, Headlee MG, Wilson JB, Lam H, Johnson SE, Webber BB, Hb Wayne, the frameshift variant with extended alpha chains observed in a Caucasian family from Alabama., Hemoglobin , 8(1), 1-15, 1984
  3. Rodríguez-Capote K, Estey MP, Barakauskas VE, Burton T, Holmes D, Krause R, Higgins TN, Identification of Hb Wayne and its effects on HbA1c measurement by 5 methods., Clin Biochem, 48(0), 1144-50, 2015
  4. Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016
Created on 2010-06-16 16:13:16, Last reviewed on 2021-04-07 12:48:47 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.