IthaID: 775
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Variant of Uncertain Significance |
|---|---|---|---|
| Common Name: | CD 139 (-A) | HGVS Name: | HBA2:c.420delA |
| Hb Name: | Hb Wayne | Protein Info: | α2 139 (-A); modified C-terminal sequence: (139)Asn-Thr-Val-Lys-Leu-Glu-Pro-(146)Arg-COOH |
Context nucleotide sequence:
CTGTGAGCACCGTGCTGACCTCCAA [A/-] TACCGTTAAGCTGGAGCCTCGGTGG (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34454 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Caucasian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Nachmansohn D, Transduction of chemical into electrical energy., Proc. Natl. Acad. Sci. U.S.A. , 73(1), 82-5, 1976
- Huisman TH, Headlee MG, Wilson JB, Lam H, Johnson SE, Webber BB, Hb Wayne, the frameshift variant with extended alpha chains observed in a Caucasian family from Alabama., Hemoglobin , 8(1), 1-15, 1984
- Moo-Penn WF, Jue DL, Johnson MH, McDonald MJ, Turci SM, Shih TB, Jones RT, Therrell BL, Arnone A, Structural and functional studies of hemoglobin Wayne: an elongated alpha-chain variant., J Mol Biol, 180(4), 1119-40, 1984
- Rodríguez-Capote K, Estey MP, Barakauskas VE, Burton T, Holmes D, Krause R, Higgins TN, Identification of Hb Wayne and its effects on HbA1c measurement by 5 methods., Clin Biochem, 48(0), 1144-50, 2015
- Henderson SJ, Timbs AT, McCarthy J, Gallienne AE, Proven M, Rugless MJ, Lopez H, Eglinton J, Dziedzic D, Beardsall M, Khalil MS, Old JM, Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations., Hemoglobin , 40(2), 75-84, 2016
Created on 2010-06-16 16:13:16,
Last reviewed on 2023-12-19 15:25:13 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.