IthaID: 77


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 17 AAG>TAG [Lys>STOP] HGVS Name: HBB:c.52A>T
Hb Name: N/A Protein Info: β 17(A14) Lys>Stop

Context nucleotide sequence:
GTCTGCCGTTACTGCCCTGTGGGGC [A/T] AGGTGAACGTGGATGAAGTTGGTGG (Strand: -)

Protein sequence:
MVHLTPEEKSAVTALWGX

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70646
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: Chinese, Japanese, Thai
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Chang JC, Kan YW, beta 0 thalassemia, a nonsense mutation in man., Proceedings of the National Academy of Sciences of the United States of America, 76(6), 2886-9, 1979
  2. Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997
  3. Turbpaiboon C, Svasti S, Sawangareetakul P, Winichagoon P, Srisomsap C, Siritanaratkul N, Fucharoen S, Wilairat P, Svasti J, Hb Siam [alpha15(A13)Gly-->Arg (alpha1) (GGT-->CGT)] is a typical alpha chain hemoglobinopathy without an alpha-thalassemic effect., Hemoglobin , 26(1), 77-81, 2002
  4. Xie J, Zhou Y, Xiao Q, Long R, Li L, Li L, Rare double heterozygosity for poly A(A〉 G) and CD17(A〉 T) of beta thalassemia intermedia in a Chinese family., Hematol Rep, 11(3), 7911, 2019
Created on 2010-06-16 16:13:14, Last reviewed on 2021-03-11 18:51:37 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.