IthaID: 75
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 16 GGC>GG- | HGVS Name: | HBB:c.51delC |
Hb Name: | N/A | Protein Info: | β 16 (-C); modified C-terminal sequence: (16)Gly-(17)Arg-COOH |
Context nucleotide sequence:
AGTCTGCCGTTACTGCCCTGTGGGG [C/-] AAGGTGAACGTGGATGAAGTTGGTG (Strand: -)
Also known as:
Comments: One additional case reported the G deletion in combination with the CD 10 (GCC>GCA) [IthaID: 65] in a male presented with severe anaemia (Hb 6.9 g/dl) and decreased level of MCV (71.8 fL), MCH (24 pg) and RBC (2.94 X 10^12/L). Hb analysis showed increased Hb A2 (6.3 %) and Hb F (19.7 %) levels.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70645 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Asian Indian, Pakistani |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Frequencies
Publications / Origin
- Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984
- Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Mohd Yasin, Norafiza | 2020-10-20 | Report of an update. |
Created on 2010-06-16 16:13:14,
Last reviewed on 2021-10-21 09:17:14 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:14 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-06-12 10:30:19 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
4 | 2016-09-02 14:46:53 | The IthaGenes Curation Team | Reviewed. Origin and Reference added. |
5 | 2021-10-21 09:17:14 | The IthaGenes Curation Team | Reviewed. Comment and contributor added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-12 12:35:12