IthaID: 75

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 16 GGC>GG- HGVS Name: HBB:c.51delC
Hb Name: N/A Protein Info: β 16 (-C); modified C-terminal sequence: (16)Gly-(17)Arg-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGTCTGCCGTTACTGCCCTGTGGGG [C/-] AAGGTGAACGTGGATGAAGTTGGTG (Strand: -)

Comments: One additional case reported the G deletion in combination with the CD 10 (GCC>GCA) [IthaID: 65] in a male presented with severe anaemia (Hb 6.9 g/dl) and decreased level of MCV (71.8 fL), MCH (24 pg) and RBC (2.94 X 10^12/L). Hb analysis showed increased Hb A2 (6.3 %) and Hb F (19.7 %) levels.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70645
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Asian Indian, Pakistani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984
  2. Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016

Microattributions

A/AContributor(s)DateComments
1Mohd Yasin, Norafiza 2020-10-20Report of an update.
Created on 2010-06-16 16:13:14, Last reviewed on 2021-10-21 09:17:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.