IthaID: 74


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 15/16 (-G) HGVS Name: HBB:c.50delG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GAGAAGTCTGCCGTTACTGCCCTGTGGG [-/G] CAAGGTGAACGTGGATGAAGTTGGTGGTG (Strand: -)

Also known as:

Comments: Found in individuals with heterozygous β-thalassaemia of German origin. Loss of a nt G in a run of four guanines in codons 15 and 16, generating a premature TGA stop between codons 19 and 20.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70644
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: German
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Vetter B, Schwarz C, Kohne E, Kulozik AE, Beta-thalassaemia in the immigrant and non-immigrant German populations., British journal of haematology, 97(2), 266-72, 1997
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-11 10:36:51 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.