IthaID: 73


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 15 TGG>TGA HGVS Name: HBB:c.48G>A
Hb Name: N/A Protein Info: β 15(A12) Trp>Stop

Context nucleotide sequence:
AGAAGTCTGCCGTTACTGCCCTGTG [A/G] GGCAAGGTGAACGTGGATGAAGTTG (Strand: -)

Protein sequence:
MVHLTPEEKSAVTALX

Also known as:

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70642
Size: 1 bp
Located at: β
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: Portuguese, Japanese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Frequencies

Publications / Origin

  1. Ribeiro ML, Baysal E, Kutlar F, Tamagnini GP, Gonçalves P, Lopes D, Huisman TH, A novel beta zero-thalassaemia mutation (codon 15, TGG----TGA) is prevalent in a population of central Portugal., British journal of haematology, 80(4), 567-8, 1992
  2. Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997
Created on 2010-06-16 16:13:14, Last reviewed on 2014-06-03 15:37:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.