IthaID: 68

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 14 (+T) HGVS Name: HBB:c.44dupT
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GAAGTCTGCCGTTACTGCCCT [-/T] GTGGGGCAAGGTGAACGTGGA (Strand: -)

Comments: Reported in a homozygous state in beta-thalassaemia major patients. The mutation in codon 14 leads to the termination of the transcript within the same exon (codons 21-22) and subsequent activation of the NMD pathway, which degrades the mutated transcript preventing its translation.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70638
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Azerbaijani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Aliyeva G, Asadov C, Mammadova T, Musayev S, Abdulalimov E, Gafarova S, Guliyeva Y, Codon 14 (+T) (HBB: c.44_45insT): a Rare β-Thalassemia Mutation Reported Only in Azerbaijan., Hemoglobin, 42(4), 276-277, 2018
Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-13 16:55:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.