IthaID: 61

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 8 (-AA) HGVS Name: HBB:c.25_26delAA
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CATGGTGCATCTGACTCCTGAGGAG [-/AA] GTCTGCCGTTACTGCCCTGTGGGGC (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70619
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Orkin SH, Goff SC, Nathan DG, Heterogeneity of DNA deletion in gamma delta beta-thalassemia., The Journal of clinical investigation, 67(3), 878-84, 1981
  2. Filon D, Faerman M, Smith P, Oppenheim A, Sequence analysis reveals a beta-thalassaemia mutation in the DNA of skeletal remains from the archaeological site of Akhziv, Israel., Nature genetics, 9(4), 365-8, 1995
  3. Bilgen T, Canatan D, Delibas S, Keser I, A Novel Mutation in the Promoter Region of the β-Globin Gene: HBB: c.-127G > C., Hemoglobin , 40(4), 280-2, 2016
Created on 2010-06-16 16:13:14, Last reviewed on 2020-07-17 09:34:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.