IthaID: 6


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: -92 (C>T) HGVS Name: HBB:c.-142C>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TCACTTAGACCTCACCCTGTGGAGC [C/T] ACACCCTAGGGTTGGCCAATCTACT (Strand: -)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70453
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Mediterranean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Frequencies

Publications / Origin

  1. Divoky V, Baysal E, Schiliro G, Dibenedetto SP, Huisman TH, A mild type of Hb S-beta(+)-thalassemia [-92(C-->T)] in a Sicilian family., American journal of hematology, 42(2), 225-6, 1993
  2. Kimberland ML, Boehm CD, Kazazian HH, Two novel beta-thalassemia alleles: poly A signal (AATAAA-->AAAA) and -92 C-->T., Human mutation, 5(3), 275-6, 1995
  3. Rosatelli MC, Faà V, Meloni A, Fiorenza F, Galanello R, Gasperini D, Amendola G, Cao A, A promoter mutation, C-->T at position -92, leading to silent beta-thalassaemia., British journal of haematology, 90(2), 483-5, 1995
Created on 2010-06-16 16:13:14, Last reviewed on 2017-06-28 12:44:58 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.