
IthaID: 6
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | -92 (C>T) | HGVS Name: | HBB:c.-142C>T |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TCACTTAGACCTCACCCTGTGGAGC [C/T] ACACCCTAGGGTTGGCCAATCTACT (Strand: -)
Comments: An updated case was reported in a 33-year-old female in association with −α3.7 with a slightly increased Hb A2 level.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β++ (silent) |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70453 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Mediterranean |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Divoky V, Baysal E, Schiliro G, Dibenedetto SP, Huisman TH, A mild type of Hb S-beta(+)-thalassemia [-92(C-->T)] in a Sicilian family., American journal of hematology, 42(2), 225-6, 1993
- Kimberland ML, Boehm CD, Kazazian HH, Two novel beta-thalassemia alleles: poly A signal (AATAAA-->AAAA) and -92 C-->T., Human mutation, 5(3), 275-6, 1995
- Rosatelli MC, Faà V, Meloni A, Fiorenza F, Galanello R, Gasperini D, Amendola G, Cao A, A promoter mutation, C-->T at position -92, leading to silent beta-thalassaemia., British journal of haematology, 90(2), 483-5, 1995
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Petrou, Miranda | 2022-09-23 | Report of an update. |
Created on 2010-06-16 16:13:14,
Last reviewed on 2022-09-23 11:11:42 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.