IthaID: 597


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 68 +GCGCTGACCAAC [+Ala-Leu-Thr-Asn] HGVS Name: HBA1:c.207_208insGCGCTGACCAAC
Hb Name: Hb Esch Protein Info: Ala-Leu-Thr-Asn- inserted between codons 68(E17) and 69(E18) of α1

Context nucleotide sequence:
GAAGGTGGCCGACGCGCTGACCAAC [-/GCGCTGAC] GCCGTGGCGCACGTGGACGACATGC (Strand: +)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37904
Size: 12 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Portuguese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Préhu C, Groff P, Kalmes G, Golinska B, Riou J, Prome D, Richelme-David S, Kiger L, Ducrocq R, Wajcman H, Short insertion in a hemoglobin chain: Hb Esch, an unstable alpha1 variant with duplication of the sequence Ala65-Leu-Thr-Asn68., Blood Cells Mol. Dis. , 31(2), 234-9, 2003
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-10 09:02:25 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.