IthaID: 57
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 6 -A | HGVS Name: | HBB:c.20delA |
| Hb Name: | N/A | Protein Info: | β 6 (-A); modified C-terminal sequence: (6)Gly-Arg-Ser-Leu-Pro-Leu-Leu-Pro-Cys-Gly- Ala-(17)Arg-COOH |
Context nucleotide sequence:
GACACCATGGTGCATCTGACTCCTG [-/A] GGAGAAGTCTGCCGTTACTGCCCTG (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70614 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Mediterranean, African-American |
| Molecular mechanism: | Altered secondary structure |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Chang JC, Alberti A, Kan YW, A beta-thalassemia lesion abolishes the same Mst II site as the sickle mutation., Nucleic acids research, 11(22), 7789-94, 1983
- Kazazian HH, Orkin SH, Boehm CD, Sexton JP, Antonarakis SE, beta-Thalassemia due to a deletion of the nucleotide which is substituted in the beta S-globin gene., American journal of human genetics, 35(5), 1028-33, 1983
- Gonzalez-Redondo JM, Stoming TA, Lanclos KD, Gu YC, Kutlar A, Kutlar F, Nakatsuji T, Deng B, Han IS, McKie VC, Clinical and genetic heterogeneity in black patients with homozygous beta-thalassemia from the southeastern United States., Blood, 72(3), 1007-14, 1988
- Petkov GH, Efremov GD, Efremov DG, Dimovski A, Tchaicarova P, Tchaicarov R, Rogina B, Agarwal S, Kutlar A, Kutlar F, Beta-thalassemia in Bulgaria., Hemoglobin, 14(1), 25-33, 1990
Created on 2010-06-16 16:13:14,
Last reviewed on 2014-04-30 09:31:16 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.