IthaID: 556
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 52-59 (-24 bp) | HGVS Name: | HBA1:c.157_180del |
| Hb Name: | Hb J-Biskra | Protein Info: | α1 51(CE9) - 58(E7) Gly-Ser-Ala-Gln-Val-Lys-Gly-His->0 OR α1 52(E1) - 59(E8) Ser-Ala-Gln-Val-Lys-Gly-His-Gly->0 |
Context nucleotide sequence:
CCCGCACTTCGACCTGAGCCACGGC [TCTGCCCAGGTTAAGGGCCACGGC/-] AAGAAGGTGGCCGACGCGCTGACCA (Strand: +)
Also known as:
Comments: Deletion of 24 base pairs (TCTGCCCAGGTTAAGGGCCACGGC) encoding for the distal histidine and surrounding nucleotides. The presence of two identical eight nucleotide sequences (GCCACGGC) at both ends of the deleted region, of which one is deleted, results in several possibilities for the limits of deletion (α50-57, α51-58 or α52-59) due to slipped mispairing during DNA replication. Residues are deleted from the middle of helix E, altering the angle CE that contracts the inside of the globin and causing instability of the α chain.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37853 |
| Size: | 24 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Algerian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Wajcman H, Dahmane M, Préhu C, Costes B, Promé D, Arous N, Bardakdjian-Michau J, Riou J, Ayache KC, Godart C, Galactéros F, Haemoglobin J-Biskra: a new mildly unstable alpha1 gene variant with a deletion of eight residues (alpha50-57, alpha51-58 or alpha52-59) including the distal histidine., Br. J. Haematol., 100(2), 401-6, 1998
- Wajcman H, de Brevern AG, Riou J, Latouche C, Marden MC, Pissard S, Short in-Frame Insertions/Deletions in the Coding Sequence of the α-Globin Gene. Consequences of the 3D Structure and Resulting Phenotypes: Hb Choisy as an Example., Hemoglobin, 42(0), 287-293, 2018