IthaID: 556


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 52-59 (-24 bp) HGVS Name: HBA1:c.157_180del
Hb Name: Hb J-Biskra Protein Info: α1 51(CE9) - 58(E7) Gly-Ser-Ala-Gln-Val-Lys-Gly-His->0 OR α1 52(E1) - 59(E8) Ser-Ala-Gln-Val-Lys-Gly-His-Gly->0

Context nucleotide sequence:
CCCGCACTTCGACCTGAGCCACGGC [TCTGCCCAGGTTAAGGGCCACGGC/-] AAGAAGGTGGCCGACGCGCTGACCA (Strand: +)

Also known as:

Comments: Deletion of 24 base pairs (TCTGCCCAGGTTAAGGGCCACGGC) encoding for the distal histidine and surrounding nucleotides. The presence of two identical eight nucleotide sequences (GCCACGGC) at both ends of the deleted region, of which one is deleted, results in several possibilities for the limits of deletion (α50-57, α51-58 or α52-59) due to slipped mispairing during DNA replication. Residues are deleted from the middle of helix E, altering the angle CE that contracts the inside of the globin and causing instability of the α chain.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37853
Size: 24 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Algerian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Wajcman H, Dahmane M, Préhu C, Costes B, Promé D, Arous N, Bardakdjian-Michau J, Riou J, Ayache KC, Godart C, Galactéros F, Haemoglobin J-Biskra: a new mildly unstable alpha1 gene variant with a deletion of eight residues (alpha50-57, alpha51-58 or alpha52-59) including the distal histidine., Br. J. Haematol., 100(2), 401-6, 1998
  2. Wajcman H, de Brevern AG, Riou J, Latouche C, Marden MC, Pissard S, Short in-Frame Insertions/Deletions in the Coding Sequence of the α-Globin Gene. Consequences of the 3D Structure and Resulting Phenotypes: Hb Choisy as an Example., Hemoglobin, 42(0), 287-293, 2018
Created on 2010-06-16 16:13:15, Last reviewed on 2023-08-04 13:29:57 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.