IthaID: 54


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 5 -CT HGVS Name: HBB:c.17_18delCT
Hb Name: N/A Protein Info: β (-CT); modified C-terminal sequence: (5)Arg-Gly-Glu-Val-Cys-Arg-Tyr-Cys-Pro-Val- Gly-Gln-Gly-Glu-Arg-(20)Gly-COOH

Context nucleotide sequence:
ACAGACACCATGGTGCATCTGACTC [-/CT] GAGGAGAAGTCTGCCGTTACTGCCC (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70611
Size: 2 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Mediterranean, Pakistani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Kollia P, Gonzalez-Redondo JM, Stoming TA, Loukopoulos D, Politis C, Huisman TH, Frameshift codon 5 [Fsc-5 (-CT)] thalassemia; a novel mutation detected in a Greek patient., Hemoglobin, 13(6), 597-604, 1989
  2. Yasmeen H, Toma S, Killeen N, Hasnain S, Foroni L, The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population., Eur J Med Genet , 59(8), 355-62, 2016
Created on 2010-06-16 16:13:14, Last reviewed on 2016-09-02 14:44:27 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.