IthaID: 53
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 2/3 (+T); CD 5 (-C) | HGVS Name: | HBB:c.[9dupT; 17delC] |
| Hb Name: | Hb Antalya | Protein Info: | β 2 - 5 His-Leu-Thr-Pro replaced with His-Ser-Asp-Ser |
Context nucleotide sequence:
AACAGACACCATGGTGCAT[-/T]CTGACTC [-/C] TGAGGAGAAGTCTGCCGTTACTGC (Strand: -)
Also known as:
Comments: Found in a proband with beta-thalassaemia trait. The amino acid residues Leu-Thr-Pro (codons 3-5) of the normal allele in the β-globin gene are changed to Ser-Asp-Ser, respectively, by insertion of a nt T between codon 2 and codon 3 (CAT [+T] CTG) and deletion of a nt C at codon 5 (CCT>C-T).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β+ Thalassaemia Dominant |
| Stability: | Hyperunstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70603 or 70611 |
| Size: | 1 bp or 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | Turkish |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Keser I, Kayisli OG, Yesilipek A, Ozes ON, Luleci G, Hb Antalya [codons 3-5 (Leu-Thr-Pro-->Ser-Asp-Ser)]: a new unstable variant leading to chronic microcytic anemia and high Hb A2., Hemoglobin, 25(4), 369-73, 2001
Created on 2010-06-16 16:13:14,
Last reviewed on 2024-04-29 12:50:12 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.