IthaID: 52

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 3 (+T)	HGVS Name:	HBB:c.11dupT
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
ACCTCAAACAGACACCATGGTGCATCT [-/T] GACTCCTGAGGAGAAGTCTGCCGTTA (Strand: -)

Also known as:

Comments: Found in three chromosomes among Turkish patients from Antalya. The insertion of a nt T in codon 3 creates a shift in the reading frame with a premature stop codon at codon 6 (TGA).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β0
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70605
Size:	1 bp
Located at:	β
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Insertion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Turkish
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	No

In silico pathogenicity prediction

Publications / Origin

Keser I, Sanlioglu AD, Manguoglu E, Guzeloglu Kayisli O, Nal N, Sargin F, Yesilipek A, Simsek M, Mendilcioglu I, Canatan D, Luleci G, Molecular analysis of beta-thalassemia and sickle cell anemia in Antalya., Acta haematologica, 111(4), 205-10, 2004

Created on 2010-06-16 16:13:14, Last reviewed on 2019-11-13 16:09:12 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:14	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2019-11-13 16:09:12	The IthaGenes Curation Team	Reviewed. Mutation names and Location corrected. Allele, Context sequence and Comment added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.