IthaID: 516
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 37 +GAA [+Glu] | HGVS Name: | HBA1:c.114_115insGAA | HBA2:c.114_115insGAA |
| Hb Name: | Hb Catonsville | Protein Info: | Glu- inserted between codons 37(C2) and 38(C3) of α1 or α2 |
Context nucleotide sequence:
CCGCAGGATGTTCCTGTCCTTCCCC [-/GAA] ACCACCAAGACCTACTTCCCGCACT (Strand: +)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34006 or 37810 |
| Size: | 3 bp or 3 bp |
| Located at: | α1 or α2 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Moo-Penn WF, Swan DC, Hine TK, Baine RM, Jue DL, Benson JM, Johnson MH, Virshup DM, Zinkham WH, Hb Catonsville (glutamic acid inserted between Pro-37(C2)alpha and Thr-38(C3)alpha). Nonallelic gene conversion in the globin system?, J. Biol. Chem. , 264(36), 21454-7, 1989
- Dash S, Das R, Late emergence of polycythemia in a case of Hb Chandigarh [beta94(FG1)Asp-->Gly]., Hemoglobin , 28(3), 273-4, 2004
Created on 2010-06-16 16:13:15,
Last reviewed on 2017-06-14 12:38:39 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.