IthaID: 51

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 2-4 (-9 bp, +31 bp)	HGVS Name:	HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT
Hb Name:	N/A	Protein Info:	β 2(NA2) - 4(A1) His-Leu-Thr->0 AND beta 2(+CCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT); modified C-terminal sequence: (2)Pro-Glu-Val-Lys-Ser-(7)Ala-COOH

Context nucleotide sequence:
AACAGACACCATGGTGC [CATCTGACT/CCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT ] CTCCTGAGGAGAAGTCT (Strand: -)

Also known as:

Comments: Found as a compound heterozygote with Hb S in twins of an Algerian family living in Southern France.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
LOVD	ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β0
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70601
Size:	9 bp
Located at:	β
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Algerian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	No

In silico pathogenicity prediction

Publications / Origin

Badens C, Thuret I, Michel G, Krawczak M, Mattei JF, Lena-Russo D, Labie D, Elion J, Novel and unusual deletion-insertion thalassemic mutation in exon 1 of the beta-globin gene., Human mutation, 8(1), 89-92, 1996

Created on 2010-06-16 16:13:14, Last reviewed on 2021-05-26 12:06:10 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:14	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-04-08 12:07:49	The IthaGenes Curation Team	Reviewed.
4	2015-12-07 12:15:12	The IthaGenes Curation Team	Reviewed. Mutation type updated
5	2019-11-07 11:38:59	The IthaGenes Curation Team	Reviewed. HGVS name corrected.
6	2019-11-07 12:57:47	The IthaGenes Curation Team	Reviewed. Type of mutation changed.
7	2021-05-26 12:05:02	The IthaGenes Curation Team	Reviewed. HGVS name corrected. Size, chromosome and locus location corrected.
8	2021-05-26 12:06:10	The IthaGenes Curation Team	Reviewed. Effect on gene added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.