IthaID: 51

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 2-4 (-9 bp, +31 bp) HGVS Name: HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT
Hb Name: N/A Protein Info: β 2(NA2) - 4(A1) His-Leu-Thr->0 AND beta 2(+CCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT); modified C-terminal sequence: (2)Pro-Glu-Val-Lys-Ser-(7)Ala-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AACAGACACCATGGTGC [CATCTGACT/CCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT ] CTCCTGAGGAGAAGTCT (Strand: -)

Comments: Found as a compound heterozygote with Hb S in twins of an Algerian family living in Southern France.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70601
Size: 9 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Algerian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Badens C, Thuret I, Michel G, Krawczak M, Mattei JF, Lena-Russo D, Labie D, Elion J, Novel and unusual deletion-insertion thalassemic mutation in exon 1 of the beta-globin gene., Human mutation, 8(1), 89-92, 1996
Created on 2010-06-16 16:13:14, Last reviewed on 2021-05-26 12:06:10 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.