IthaID: 446


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 6 -GAC [-Asp] HGVS Name: HBA1:c.19_21delGAC | HBA2:c.19_21delGAC
Hb Name: Hb Boyle Heights Protein Info: α1 or α2 6(A4) Asp->0

Context nucleotide sequence:
ACCCACCATGGTGCTGTCTCCTGCC [-/GAC] AAGACCAACGTCAAGGCCGCCTGGG (Strand: +)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33794 or 37598
Size: 3 bp or 3 bp
Located at: α1 or α2
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Mexican
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Johnson CS, Schroeder WA, Shelton JB, Shelton JR, The first example of a deletion in the human alpha chain: hemoglobin Boyle Heights or alpha 2 6 (A4) Asp----to O beta 2., Hemoglobin , 7(2), 125-40, 1983
  2. Zhao W, Wilson JB, Huisman TH, Low quantities of Hb Boyle Heights or alpha 2(6)(A4)Asp----O beta 2 observed in three members of a Caucasian family., Hemoglobin , 14(6), 637-40, 1990
Created on 2010-06-16 16:13:15, Last reviewed on 2014-03-12 15:49:13 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.