IthaID: 428


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: 3'UTR -16 bp HGVS Name: HBA2:c.*74_*89delCCTTCCTGGTCTTTGA
Hb Name: N/A Protein Info: α2 nts 799 - 814 deleted

Context nucleotide sequence:
GCCCTCCTCCCCTCCTTGCACCGGC [-/CCTTCCTGGTCTTTGA] ATAAAGTCTGAGTGGGCAGCAGCCT (Strand: +)

Also known as:

Comments: 3'UTR -16 bp (giving rise to CATAAA)

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α+/α0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34537
Size: 16 bp
Located at: α2
Specific Location: 3'UTR, Poly(A)

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Arab
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Tamary H, Klinger G, Shalmon L, Attias D, Fortina P, Kobayashi M, Surrey S, Zaizov R, alpha-thalassemia caused by a 16 bp deletion in the 3' untranslated region of the alpha 2-globin gene including the first nucleotide of the poly A signal sequence., Hemoglobin, 21(2), 121-30, 1997
Created on 2010-06-16 16:13:15, Last reviewed on 2023-07-14 11:54:28 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.