IthaID: 425


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: Poly A (AATAAA>AATGAA) HGVS Name: HBA2:c.*92A>G
Hb Name: N/A Protein Info: α2 nt 817 A>G

Context nucleotide sequence:
CACCGGCCCTTCCTGGTCTTTGAAT [A/G] AAGTCTGAGTGGGCAGCAGCCTGTG (Strand: +)

Also known as: αPolyA2

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α+/α0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34555
Size: 1 bp
Located at: α2
Specific Location: Poly(A)

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin: Mediterranean, Turkish, Cypriot, UAE, Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Yüregir GT, Aksoy K, Cürük MA, Dikmen N, Fei YJ, Baysal E, Huisman TH, Hb H disease in a Turkish family resulting from the interaction of a deletional alpha-thalassaemia-1 and a newly discovered poly A mutation., British journal of haematology, 80(4), 527-32, 1992
  2. Baysal E, Kleanthous M, Bozkurt G, Kyrri A, Kalogirou E, Angastiniotis M, Ioannou P, Huisman TH, alpha-Thalassaemia in the population of Cyprus., Br. J. Haematol. , 89(3), 496-9, 1995
  3. Kyriacou K, Kyrri A, Kalogirou E, Vasiliades P, Angastiniotis M, Ioannou PA, Kleanthous M, Hb Bart's levels in cord blood and alpha-thalassemia mutations in Cyprus., Hemoglobin , 24(3), 171-80, 2000
  4. Ma ES, Chow EY, Chan AY, Chan LC, Interaction between (--SEA) alpha-thalassemia deletion and uncommon non-deletional alpha-globin gene mutations in Chinese patients., Haematologica , 86(5), 539-40, 2001
  5. Hadavi V, Taromchi AH, Malekpour M, Gholami B, Law HY, Almadani N, Afroozan F, Sahebjam F, Pajouh P, Kariminejad R, Kariminejad MH, Azarkeivan A, Jafroodi M, Tamaddoni A, Puehringer H, Oberkanins C, Najmabadi H, Elucidating the spectrum of alpha-thalassemia mutations in Iran., Haematologica , 92(7), 992-3, 2007
  6. Akhavan-Niaki H, Youssefi Kamangari R, Banihashemi A, Kholghi Oskooei V, Azizi M, Tamaddoni A, Sedaghat S, Vakili M, Mahmoudi Nesheli H, Shabani S, Hematologic features of alpha thalassemia carriers., Int J Mol Cell Med , 1(3), 162-7, 2012
Created on 2010-06-16 16:13:15, Last reviewed on 2020-10-02 10:23:28 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.