IthaID: 425
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | Poly A (AATAAA>AATGAA) | HGVS Name: | HBA2:c.*92A>G |
Hb Name: | N/A | Protein Info: | α2 nt 817 A>G |
Context nucleotide sequence:
CACCGGCCCTTCCTGGTCTTTGAAT [A/G] AAGTCTGAGTGGGCAGCAGCCTGTG (Strand: +)
Also known as: αPolyA2
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α+/α0 |
Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34555 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Poly(A) |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
Ethnic Origin: | Mediterranean, Turkish, Cypriot, UAE, Iranian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Frequencies
Publications / Origin
- Yüregir GT, Aksoy K, Cürük MA, Dikmen N, Fei YJ, Baysal E, Huisman TH, Hb H disease in a Turkish family resulting from the interaction of a deletional alpha-thalassaemia-1 and a newly discovered poly A mutation., British journal of haematology, 80(4), 527-32, 1992
- Baysal E, Kleanthous M, Bozkurt G, Kyrri A, Kalogirou E, Angastiniotis M, Ioannou P, Huisman TH, alpha-Thalassaemia in the population of Cyprus., Br. J. Haematol. , 89(3), 496-9, 1995
- Kyriacou K, Kyrri A, Kalogirou E, Vasiliades P, Angastiniotis M, Ioannou PA, Kleanthous M, Hb Bart's levels in cord blood and alpha-thalassemia mutations in Cyprus., Hemoglobin , 24(3), 171-80, 2000
- Ma ES, Chow EY, Chan AY, Chan LC, Interaction between (--SEA) alpha-thalassemia deletion and uncommon non-deletional alpha-globin gene mutations in Chinese patients., Haematologica , 86(5), 539-40, 2001
- Hadavi V, Taromchi AH, Malekpour M, Gholami B, Law HY, Almadani N, Afroozan F, Sahebjam F, Pajouh P, Kariminejad R, Kariminejad MH, Azarkeivan A, Jafroodi M, Tamaddoni A, Puehringer H, Oberkanins C, Najmabadi H, Elucidating the spectrum of alpha-thalassemia mutations in Iran., Haematologica , 92(7), 992-3, 2007
- Akhavan-Niaki H, Youssefi Kamangari R, Banihashemi A, Kholghi Oskooei V, Azizi M, Tamaddoni A, Sedaghat S, Vakili M, Mahmoudi Nesheli H, Shabani S, Hematologic features of alpha thalassemia carriers., Int J Mol Cell Med , 1(3), 162-7, 2012
Created on 2010-06-16 16:13:15,
Last reviewed on 2020-10-02 10:23:28 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-04-08 17:52:47 | The IthaGenes Curation Team | Reviewed. |
4 | 2014-10-20 11:00:35 | The IthaGenes Curation Team | Reviewed. |
5 | 2014-10-21 12:32:12 | The IthaGenes Curation Team | Reviewed. Publication list updated. |
6 | 2020-10-02 10:23:28 | The IthaGenes Curation Team | Reviewed. Name edits. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36