IthaID: 424
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Poly A (AATAAA>AATAAG) | HGVS Name: | HBA2:c.*94A>G |
| Hb Name: | N/A | Protein Info: | α2 nt 819 A>G |
Context nucleotide sequence:
CCGGCCCTTCCTGGTCTTTGAATAA [A/C/G] GTCTGAGTGGGCGGCAGCCTGTGTG (Strand: +)
Also known as: αPolyA1, αT-Saudi
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α+/α0 |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34557 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | Arab, Middle East, Mediterranean |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Higgs DR, Goodbourn SE, Lamb J, Clegg JB, Weatherall DJ, Proudfoot NJ, Alpha-thalassaemia caused by a polyadenylation signal mutation., Nature , 306(5941), 398-400, 1983
- Whitelaw E, Proudfoot N, Alpha-thalassaemia caused by a poly(A) site mutation reveals that transcriptional termination is linked to 3' end processing in the human alpha 2 globin gene., EMBO J. , 5(11), 2915-22, 1986
- Thein SL, Wallace RB, Pressley L, Clegg JB, Weatherall DJ, Higgs DR, The polyadenylation site mutation in the alpha-globin gene cluster., Blood , 71(2), 313-9, 1988
- Fei YJ, Oner R, Bözkurt G, Gu LH, Altay C, Gurgey A, Fattoum S, Baysal E, Huisman TH, Hb H disease caused by a homozygosity for the AATAAA-->AATAAG mutation in the polyadenylation site of the alpha 2-globin gene: hematological observations., Acta Haematol. , 88(2), 82-5, 1992
- Adekile AD, Gu LH, Baysal E, Haider MZ, al-Fuzae L, Aboobacker KC, al-Rashied A, Huisman TH, Molecular characterization of alpha-thalassemia determinants, beta-thalassemia alleles, and beta S haplotypes among Kuwaiti Arabs., Acta Haematol. , 92(4), 176-81, 1994
- Viprakasit V, Green S, Height S, Ayyub H, Higgs DR, Hb H hydrops fetalis syndrome associated with the interaction of two common determinants of alpha thalassaemia (--MED/(alpha)TSaudi(alpha))., Br. J. Haematol. , 117(3), 759-62, 2002
- Baysal E, α-Thalassemia syndromes in the United Arab Emirates., Hemoglobin , 35(5), 574-80, 2011
Created on 2010-06-16 16:13:15,
Last reviewed on 2020-10-02 10:23:44 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.