IthaID: 4111
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | Poly A (AATAAA>AAΑΑΑ) | HGVS Name: | HBA2:c.*91delT |
| Hb Name: | N/A | Protein Info: | α2 nt 816 delT |
Context nucleotide sequence:
GCACCGGCCCTTCCTGGTCTTTGAA [T/-] AAAGTCTGAGTGGGCAGCAGCCTGTG (Strand: +)
Also known as:
Comments: Found as a novel mutation in a Chinese patient, in compound heterozygosity with –SEA [IthaID: 309], leading to severe non-deletional Hb H disease with blood transfusion dependence since infancy.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α+/α0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34554 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ren ZM, Li WJ, Xing ZH, Fu XY, Zhang JY, Chen YS, Li DF, Detecting rare thalassemia in children with anemia using third-generation sequencing., Hematology, 28(1), 2241226, 2023
Created on 2024-10-23 15:23:06,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.