
IthaID: 4104
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 147 TAA>ΑAC [Stop>Tyr] | HGVS Name: | HBB:c.444A>C |
Hb Name: | N/A | Protein Info: | β 147, Stop>Tyr; modified C-terminal sequence: (147)Tyr-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AATGCCCTGGCCCACAAGTATCACTA [A/C] GCTCGCTTTCTTGCTGTCCAATTTCT (Strand: -)
Comments: Reported as a de novo mutation in a 2-month-old infant girl, presented with persistent jaundice and failure to thrive. The infant was diagnosed with β-thalassemia. This mutation results in a stop-codon substitution to a tyrosine residue and an increase of 21 amino-acids in the β-globin chain that probably makes the protein unstable. Leads to a dominant beta-thalassemia state according to this case report.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72018 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Nonsense codon (Translation) |
Ethnic Origin: | Danish |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ravichandran S, Hoffmann M, Petersen J, Sjø L, Rasmussen AØ, Eidesgaard A, Glenthøj A, A Rare Case of Beta-Thalassemia Diagnosed by Whole-Genome Sequencing in an Ethnically Danish Newborn., Hemoglobin, 2024
Created on 2024-07-23 16:18:31,
Last reviewed on 2024-07-23 16:21:36 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.