IthaID: 4094


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 54 GTT>-TT HGVS Name: HBB:c.163del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGGGGATCTGTCCACTCCTGATGCT [G/-] TTATGGGCAACCCTAAGGTGAAGG (Strand: -)

Also known as:

Comments: Frameshift variant co-inherited with Hb E in a 21 year-old individual with a thalassemia intermedia type of clinical manifestation and with more than 70 transfusions. The deletion of 'G' at position c.163 generates a premature stop codon after seven codons, leading to a truncated protein. Assumed de novo as it was not detected in the father, mother and siblings.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70887
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Mamata M, Padma G, Pragna Laxmi T, Saroja K, Ashwin D, Suman J, Identification of a Novel Variant in Gene Resulting in a Beta Null Phenotype in a Proband with Thalassemia Intermedia., Hemoglobin, 2024
Created on 2024-02-21 13:01:42, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.